ID: 908009165

View in Genome Browser
Species Human (GRCh38)
Location 1:59758155-59758177
Sequence CTAAGGCTGCAGAACTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908009161_908009165 5 Left 908009161 1:59758127-59758149 CCAGGGAGGTAATGTCACCTTCA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 908009165 1:59758155-59758177 CTAAGGCTGCAGAACTATGTAGG 0: 1
1: 0
2: 1
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908009165 Original CRISPR CTAAGGCTGCAGAACTATGT AGG Intronic