ID: 908009165 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:59758155-59758177 |
| Sequence | CTAAGGCTGCAGAACTATGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 133 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 120} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 908009161_908009165 | 5 | Left | 908009161 | 1:59758127-59758149 | CCAGGGAGGTAATGTCACCTTCA | 0: 1 1: 0 2: 0 3: 13 4: 144 |
||
| Right | 908009165 | 1:59758155-59758177 | CTAAGGCTGCAGAACTATGTAGG | 0: 1 1: 0 2: 1 3: 11 4: 120 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 908009165 | Original CRISPR | CTAAGGCTGCAGAACTATGT AGG | Intronic | ||