ID: 908010350

View in Genome Browser
Species Human (GRCh38)
Location 1:59769845-59769867
Sequence CACAAGATCCTTCAACCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908010350_908010352 24 Left 908010350 1:59769845-59769867 CCTTGTGGTTGAAGGATCTTGTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 908010352 1:59769892-59769914 GAAATTATGTGTGTTATTTCCGG 0: 1
1: 1
2: 3
3: 56
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908010350 Original CRISPR CACAAGATCCTTCAACCACA AGG (reversed) Intergenic
901069440 1:6509817-6509839 CACAAGACCCTGCACGCACAGGG + Intronic
903862194 1:26371297-26371319 CAAAAGATAATTCAAGCACATGG + Intronic
904661906 1:32091723-32091745 GACAAGCCTCTTCAACCACATGG + Exonic
907950918 1:59182815-59182837 TAGGAGATCCTTCAACCACTTGG + Intergenic
908010350 1:59769845-59769867 CACAAGATCCTTCAACCACAAGG - Intergenic
909244594 1:73263312-73263334 CACAATATCCTTATACAACATGG - Intergenic
910927176 1:92409555-92409577 CTCAAGATCCCCCAAACACATGG - Intergenic
912081829 1:105946591-105946613 CACAAAATCGTCCAACTACATGG - Intergenic
912793604 1:112675694-112675716 CCAAAGAGCCTTCAGCCACAGGG - Intronic
916042455 1:160973058-160973080 CACAAGAACCTTCAACTACCTGG + Intergenic
916949542 1:169765291-169765313 CATAGAATCCTTCAACCACAAGG - Intronic
917373843 1:174326235-174326257 CACCAGATCATTCATCTACATGG - Intronic
919987900 1:202688728-202688750 CACAAGCTCCTTCCACCATCAGG - Intronic
1070518398 10:77229091-77229113 CTCAAGTTCCTTCAAGAACATGG - Intronic
1072610174 10:97012687-97012709 CACAAGAGCCTCCATCCAAATGG - Intronic
1076329547 10:129654381-129654403 CACAAGAGGCTTCAAAGACATGG - Intronic
1092807561 12:12239200-12239222 ACCAAGATCCTTCATACACAGGG + Intronic
1097425016 12:59433700-59433722 CATAAGACCCATCAACCAAAAGG - Intergenic
1097964725 12:65566524-65566546 CACCACAGCCCTCAACCACAGGG + Intergenic
1098130351 12:67343748-67343770 CACACCATCCCTCAACCCCAAGG - Intergenic
1102184275 12:110935416-110935438 CACAATATCCTGCAACAAAATGG + Intergenic
1104266049 12:127233302-127233324 CCCAAGCTCCTTCCATCACATGG - Intergenic
1106315683 13:28591267-28591289 CACAGAGTCCTTCAAACACATGG + Intergenic
1108001588 13:45909910-45909932 CCCAGGGTCCTACAACCACATGG - Intergenic
1108552958 13:51564845-51564867 CACAAGTTCCTTGAGCCCCAGGG + Intergenic
1112798825 13:103088077-103088099 CACAAGATTCTGCCTCCACAAGG - Intergenic
1113148358 13:107234422-107234444 CACAAAATCCTGCCACCTCAAGG - Intronic
1113512567 13:110867750-110867772 CAGAAAATCCTCAAACCACAGGG - Intergenic
1113514172 13:110879081-110879103 AACTAAAACCTTCAACCACATGG + Exonic
1114311383 14:21470775-21470797 CACATGATGGTTCAATCACATGG + Intronic
1115925737 14:38431370-38431392 CTCAAGTTCCACCAACCACAGGG - Intergenic
1118849152 14:69571540-69571562 CACGCGATCCTTCGACCGCATGG - Exonic
1120368205 14:83597422-83597444 CACATTATCCATCAAACACATGG - Intergenic
1120543421 14:85779776-85779798 CATAAAATGCTGCAACCACAAGG - Intergenic
1126040835 15:44589352-44589374 CACCTGATCCTCCAGCCACATGG + Exonic
1133033343 16:3021915-3021937 GCCAAGCTCCTCCAACCACAAGG + Exonic
1135885743 16:26305612-26305634 CACAAAAGCCTCCAAACACAGGG - Intergenic
1140199072 16:72879840-72879862 CACAAGAACCTTCCTCCACGTGG + Intronic
1140992832 16:80230923-80230945 CAAAACTTCCTTAAACCACAAGG + Intergenic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1146587183 17:34092344-34092366 CTCCAGCTCCTTTAACCACAAGG + Intronic
1154276224 18:12962999-12963021 CACAAGTTCCTACAAGTACATGG - Intronic
1162241870 19:9361853-9361875 CAGAAGATCCTTAAAGCACTAGG - Intronic
1162829982 19:13278344-13278366 CCCAAGATGCTTCCACCTCAGGG + Intronic
1163898783 19:20082475-20082497 CACATGTTCCTGCAAGCACAGGG - Intronic
1164189167 19:22899558-22899580 CACAGGAACCTCCACCCACAAGG + Intergenic
1164437653 19:28245557-28245579 CACTGGATCCCTCAAGCACATGG + Intergenic
1164622347 19:29704084-29704106 CCCCAGGTCCTTTAACCACATGG - Intronic
1164748184 19:30631183-30631205 CACCAGATGCTTCAAGCAGATGG - Intronic
1165765305 19:38346749-38346771 CACAAGATTCTACAGCCAGAGGG + Intronic
1167211520 19:48136764-48136786 CACAGCATGCTTCACCCACAGGG + Intronic
1168634086 19:57981707-57981729 CACAAGATCCACCAACCCAAAGG + Intronic
1202677555 1_KI270711v1_random:21384-21406 GACAAGATGATTCAACCACAAGG + Intergenic
925041353 2:733701-733723 CACAGGACCCTGCAGCCACACGG + Intergenic
926264843 2:11306580-11306602 CATAAAATCCTTTAAACACAAGG + Intronic
928260191 2:29759687-29759709 CACAAGATCATGCAACCCAAAGG - Intronic
932284241 2:70519025-70519047 CAGAACATCCTTCATCCAAAAGG - Intronic
935106151 2:100045510-100045532 CAGTTGATCCTTCAACAACATGG + Intronic
937040477 2:118816729-118816751 CCCAAGATCATTCAAAAACATGG + Intergenic
937320418 2:120957493-120957515 CACATGATCCTTCATGCACTCGG - Intronic
938619522 2:133034265-133034287 GAAAATATCCTTCAAACACAAGG + Intronic
939180519 2:138797131-138797153 AACAAGCTCCTTCAACCTAAAGG + Intergenic
942705733 2:178769824-178769846 CACACCATTCTTCAGCCACATGG + Exonic
943653743 2:190485203-190485225 CACAAACTCTTCCAACCACAGGG - Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
947376467 2:229501745-229501767 CACAAAAACCTTCAAACAGAGGG - Intronic
948904513 2:240972258-240972280 TCCAAGATCCTGCAGCCACAGGG + Intronic
1171086743 20:22244773-22244795 CTTAAGATCCTTCAAGCACATGG + Intergenic
1172590944 20:36117443-36117465 CTTAGGATCCTTCAACCCCATGG + Intronic
1174133830 20:48365086-48365108 CACCAGACCCCACAACCACAGGG - Intergenic
1175192932 20:57223734-57223756 AACAAGAAGCCTCAACCACAGGG + Intronic
1178129016 21:29548639-29548661 CACATGACCCTTATACCACAAGG - Intronic
1179787459 21:43737884-43737906 CACAAGAACCTTCTCCAACAGGG - Intronic
1180057980 21:45368818-45368840 CCCAGGATCCTGCAAGCACAAGG - Intergenic
1185016973 22:48350250-48350272 CACAAGGTCCTACAGCTACATGG + Intergenic
950872847 3:16244326-16244348 CACAAAATCCTTAAACTAAATGG + Intergenic
953217351 3:40931589-40931611 CTCAAGTTCCTTCAAACACCTGG + Intergenic
958037241 3:88184790-88184812 CACAAAACCGTTCAACTACATGG + Intergenic
958071132 3:88613451-88613473 CACAAGATACGTGAAACACAAGG - Intergenic
961573938 3:127819865-127819887 CCCAAGATCCAGCAAGCACAGGG + Intronic
963469306 3:145718355-145718377 CAGTTGATCCTTCAACAACATGG - Intergenic
963578313 3:147091620-147091642 CACAAACTCTTTCAACTACATGG + Intergenic
967933313 3:194706504-194706526 CTCAAAATCCTTCAAACCCACGG - Intergenic
969150206 4:5162922-5162944 CAGCAGATCCCTCAATCACATGG + Intronic
971142531 4:23939893-23939915 CATATTATCCCTCAACCACAAGG + Intergenic
974965822 4:68759830-68759852 CACCAGAACCCTCAACCCCATGG - Intergenic
978342265 4:107731036-107731058 CACAAGGTCCCACAATCACAAGG + Intergenic
982118147 4:152114987-152115009 CTCAGGATCAGTCAACCACATGG - Intergenic
982231801 4:153215318-153215340 CTCATGATCCTTGAACCCCAAGG - Intronic
983218420 4:165022021-165022043 CACAAGCCCCTTCACACACATGG + Intergenic
985160655 4:187041101-187041123 CACAAAATACTTTCACCACAGGG + Intergenic
985753362 5:1696755-1696777 CATAAGATCCTTCAACTGCTTGG - Intergenic
986580311 5:9258945-9258967 CCCAAGTACCTGCAACCACAGGG + Intronic
988427126 5:31076683-31076705 CACAAGAGCCTTGAAACACATGG + Intergenic
988644626 5:33080734-33080756 TACATGATACTTCAAACACATGG + Intergenic
989456766 5:41653165-41653187 TATTAGATCCTGCAACCACAGGG + Intergenic
990851617 5:60211246-60211268 CACAAACTCCTTCAACCTCCAGG - Intronic
992642455 5:78779927-78779949 AACATGATCCTTCACCGACAGGG + Exonic
994944222 5:106364444-106364466 AACAATATCCTTATACCACAGGG + Intergenic
995534534 5:113121846-113121868 CTCCACACCCTTCAACCACAGGG + Intronic
1003279859 6:4681697-4681719 CACAAAATCCTTGAACCTCGTGG - Intergenic
1004683785 6:17922124-17922146 GACAAGATCCTGCAGACACAGGG + Intronic
1008628931 6:53345702-53345724 AACAAGAACCTTTAAACACAAGG + Intronic
1010352080 6:74886578-74886600 CACAAAACCGCTCAACCACATGG - Intergenic
1014111059 6:117618999-117619021 CACAAGGCCCCTCAACCCCAAGG + Intergenic
1015261005 6:131238198-131238220 CTCAAAACCGTTCAACCACATGG - Intronic
1016522636 6:144963733-144963755 CACAAGAAACTCAAACCACATGG + Intergenic
1022897130 7:34761801-34761823 CACAAGATCATTGCACAACATGG - Intronic
1023678263 7:42653874-42653896 CACATTCTCCTTCAAACACAGGG - Intergenic
1024367272 7:48535527-48535549 CACCTGATCCTTCTTCCACAAGG - Intronic
1024678237 7:51657305-51657327 CACAAAATCCCTTAACCACGGGG + Intergenic
1024730048 7:52243726-52243748 CACAACAACCTTCATCCCCAGGG + Intergenic
1026679767 7:72456871-72456893 TAAAAGATCCCTCAACCATACGG + Intergenic
1028423234 7:90656761-90656783 CACAAGATGCTCTAACTACATGG - Intronic
1030063205 7:105639486-105639508 CACAAGATCCCTCACCTGCAAGG - Exonic
1030771307 7:113477580-113477602 GAAAAGACCATTCAACCACAGGG - Intergenic
1031286438 7:119875462-119875484 CTCAAGTTCCTTCAGCCATAGGG - Intergenic
1031839096 7:126715693-126715715 CAGTAGATCCTTAAACAACATGG - Intronic
1032109199 7:129060830-129060852 CACATCATCCTCCAACCTCAGGG + Intergenic
1032995697 7:137443852-137443874 CACAATATTCGTCAACCAGACGG + Intronic
1037066307 8:14582340-14582362 CAGTAGACCCTTCAACAACAGGG - Intronic
1041484048 8:58354518-58354540 CACTTGATCCTTGAACAACACGG + Intergenic
1044974116 8:97646506-97646528 CACAATGTGCTTCATCCACATGG - Intronic
1047541444 8:125770422-125770444 CACTTGATCCTTGAACAACATGG + Intergenic
1048453095 8:134551465-134551487 CACAAGAAAGTTCCACCACAAGG - Intronic
1055381452 9:75711677-75711699 CACAAAATGCTTCCACCTCAGGG + Intergenic
1056485895 9:87057879-87057901 CAGAAAATTCTACAACCACATGG + Intergenic
1056754739 9:89374608-89374630 CCCCAGATATTTCAACCACAGGG - Intronic
1057034598 9:91802567-91802589 CACAGGCAACTTCAACCACAGGG + Intronic
1058558260 9:106194633-106194655 AAAAAAATCCTTCAAACACAAGG - Intergenic
1061331010 9:129893207-129893229 CAGCTGACCCTTCAACCACAAGG - Intronic
1189087595 X:38042512-38042534 CAGAGGATCCTTGAACAACATGG - Intronic
1189655915 X:43244990-43245012 CACAAATTCCCTCAACAACAGGG - Intergenic
1194795500 X:98207276-98207298 TACAATATCCTTAAACAACAAGG + Intergenic
1195846220 X:109231637-109231659 CTCAAAATCATTCAACTACATGG + Intergenic
1197697921 X:129570765-129570787 CAGTTGATCCTTCAACAACATGG + Intronic
1198044234 X:132884135-132884157 CACAAAATCCATGAGCCACATGG - Intronic
1200096297 X:153665665-153665687 CACAACCTCCCTCAACCAGACGG + Intergenic
1200734913 Y:6783954-6783976 CACAAGGTCCCTCATCCCCAAGG + Intergenic