ID: 908016578

View in Genome Browser
Species Human (GRCh38)
Location 1:59845099-59845121
Sequence ATCTGCTGGTACCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5569
Summary {0: 5, 1: 83, 2: 644, 3: 1657, 4: 3180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908016578_908016580 -6 Left 908016578 1:59845099-59845121 CCAAAATCAAGGTACCAGCAGAT 0: 5
1: 83
2: 644
3: 1657
4: 3180
Right 908016580 1:59845116-59845138 GCAGATTCAGTGTCTGTTTGAGG No data
908016578_908016582 18 Left 908016578 1:59845099-59845121 CCAAAATCAAGGTACCAGCAGAT 0: 5
1: 83
2: 644
3: 1657
4: 3180
Right 908016582 1:59845140-59845162 ATAGCTCTCTGCCTCCAAGATGG 0: 1
1: 2
2: 6
3: 78
4: 511
908016578_908016581 -5 Left 908016578 1:59845099-59845121 CCAAAATCAAGGTACCAGCAGAT 0: 5
1: 83
2: 644
3: 1657
4: 3180
Right 908016581 1:59845117-59845139 CAGATTCAGTGTCTGTTTGAGGG 0: 1
1: 1
2: 4
3: 40
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908016578 Original CRISPR ATCTGCTGGTACCTTGATTT TGG (reversed) Intronic
Too many off-targets to display for this crispr