ID: 908030927

View in Genome Browser
Species Human (GRCh38)
Location 1:59998623-59998645
Sequence CTATCTGCATAGTTTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908030920_908030927 20 Left 908030920 1:59998580-59998602 CCTTCCTGCTGACCCACACAGCT No data
Right 908030927 1:59998623-59998645 CTATCTGCATAGTTTAGGACTGG No data
908030919_908030927 21 Left 908030919 1:59998579-59998601 CCCTTCCTGCTGACCCACACAGC No data
Right 908030927 1:59998623-59998645 CTATCTGCATAGTTTAGGACTGG No data
908030924_908030927 7 Left 908030924 1:59998593-59998615 CCACACAGCTGTGGAAAGAACTG No data
Right 908030927 1:59998623-59998645 CTATCTGCATAGTTTAGGACTGG No data
908030921_908030927 16 Left 908030921 1:59998584-59998606 CCTGCTGACCCACACAGCTGTGG 0: 1
1: 0
2: 2
3: 23
4: 241
Right 908030927 1:59998623-59998645 CTATCTGCATAGTTTAGGACTGG No data
908030923_908030927 8 Left 908030923 1:59998592-59998614 CCCACACAGCTGTGGAAAGAACT No data
Right 908030927 1:59998623-59998645 CTATCTGCATAGTTTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908030927 Original CRISPR CTATCTGCATAGTTTAGGAC TGG Intronic
No off target data available for this crispr