ID: 908035257

View in Genome Browser
Species Human (GRCh38)
Location 1:60044627-60044649
Sequence TCTGAAGCCCAGCCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908035257_908035260 6 Left 908035257 1:60044627-60044649 CCAGCTGCAGGCTGGGCTTCAGA 0: 1
1: 0
2: 3
3: 42
4: 367
Right 908035260 1:60044656-60044678 CCTTGCTGATTTAAGTCACCTGG No data
908035257_908035262 8 Left 908035257 1:60044627-60044649 CCAGCTGCAGGCTGGGCTTCAGA 0: 1
1: 0
2: 3
3: 42
4: 367
Right 908035262 1:60044658-60044680 TTGCTGATTTAAGTCACCTGGGG No data
908035257_908035261 7 Left 908035257 1:60044627-60044649 CCAGCTGCAGGCTGGGCTTCAGA 0: 1
1: 0
2: 3
3: 42
4: 367
Right 908035261 1:60044657-60044679 CTTGCTGATTTAAGTCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908035257 Original CRISPR TCTGAAGCCCAGCCTGCAGC TGG (reversed) Intronic
900158268 1:1212104-1212126 TGGGAAGCACACCCTGCAGCCGG - Exonic
900210175 1:1451741-1451763 CCTTAAGCCCAGCCTGAATCAGG + Intronic
900215725 1:1480562-1480584 CCTTAAGCCCAGCCTGAATCAGG + Intronic
900473685 1:2866503-2866525 CCTCAAGCCCAGCCTGCCCCCGG - Intergenic
900503049 1:3016057-3016079 TTTCTAGCCCAGCCTGCAGTCGG + Intergenic
900601090 1:3502917-3502939 TCTGATGCCCTGCCTGCTGCTGG + Intronic
900799212 1:4727202-4727224 TTTGCAGCCCAGCGGGCAGCAGG + Intronic
901113519 1:6818980-6819002 TCTGTTGCCCAGGCTGGAGCAGG + Intronic
902923009 1:19678641-19678663 CCTGAAGGCCAGCCTGACGCTGG + Exonic
903060694 1:20666547-20666569 TCTCCAGCCAAGCCTGCACCCGG + Intronic
903464886 1:23545200-23545222 CCAGGAGCCCAGCCTCCAGCAGG - Intergenic
903807680 1:26017171-26017193 TTTCAGGCCCAGCCTGAAGCGGG + Intergenic
904255668 1:29253005-29253027 TGGGAACCCCAACCTGCAGCGGG - Intronic
904533216 1:31182348-31182370 TCTGGACCCCAGCCTGGAACGGG + Intronic
904581048 1:31544552-31544574 TCTGAGGCACACCCTGCACCTGG - Intergenic
905299346 1:36975876-36975898 TCTGTATCCCAGCATGTAGCAGG + Intronic
905404353 1:37723095-37723117 ACAGATGCACAGCCTGCAGCAGG + Exonic
905795996 1:40817019-40817041 TCTGAGCTGCAGCCTGCAGCAGG + Intronic
905911476 1:41657910-41657932 TGAGAAGCCCAGCCAGCAGGAGG - Intronic
906223671 1:44103549-44103571 TCTGCATCCCAGACTCCAGCCGG + Intergenic
907218478 1:52886561-52886583 TCTGTTGCCCAGGCTGGAGCTGG + Intronic
907886307 1:58595091-58595113 CCTGAAGCCCACCCTACAGTTGG + Intergenic
908035257 1:60044627-60044649 TCTGAAGCCCAGCCTGCAGCTGG - Intronic
908313976 1:62914703-62914725 TCTGAAACCCATCCTGCCTCAGG - Intergenic
908535549 1:65073199-65073221 TCACAAGCCCAGCCAGCAGCTGG - Intergenic
909352017 1:74665175-74665197 TCTGTCGCCCAGGCTGCAGATGG - Intronic
910095751 1:83519805-83519827 TCTGAAGACCAGACTGAAGGAGG + Intergenic
912449218 1:109759087-109759109 ACTGAAGACCAGCCTGCAGAAGG - Exonic
912557960 1:110529882-110529904 TCTGAATCCCAGGCACCAGCTGG - Intergenic
913057955 1:115179429-115179451 GGTGAAGCCCAGCCTGCCCCTGG - Intergenic
914340220 1:146753895-146753917 TCTGAATCCCATCTTGCAGTTGG + Intergenic
914939142 1:152006833-152006855 GCTGAGGCCCCCCCTGCAGCGGG + Intergenic
915619839 1:157074452-157074474 TCTGCATCCCAGACTCCAGCCGG - Intergenic
915922141 1:159983963-159983985 TCTGCAGCCCTGGCTGCTGCAGG - Intergenic
916432595 1:164745653-164745675 GCTTTAGCCCAGCCTGTAGCTGG - Intronic
916825951 1:168441948-168441970 TCAGCAGCTCACCCTGCAGCTGG - Intergenic
917296214 1:173522111-173522133 TCTCCTGCCCAGCCTGTAGCTGG - Intronic
917838722 1:178960686-178960708 TCTGAAGTGCAGGCTGCACCGGG - Intergenic
919743214 1:200992766-200992788 TCTGCAGCTCAGCCTTCAGCAGG - Intronic
919958267 1:202439704-202439726 TGTGCAGCCCAGCCAGCAGGAGG + Intronic
920270814 1:204762420-204762442 ACTGCAGCCCAGCCTACACCTGG - Intergenic
920535320 1:206733360-206733382 TCTGCAGCCCTGCCTGCCCCTGG - Exonic
920776497 1:208943261-208943283 ACTGAAGCCCAGCTTGGACCAGG + Intergenic
922363395 1:224843128-224843150 TCAGAAGCCCATGCTGTAGCAGG + Intergenic
924624438 1:245687606-245687628 TCAGAAGGCCAGCCGGCAGGAGG + Exonic
924707964 1:246513444-246513466 GCTGAAGCCCAGCCAGCTGGAGG + Intergenic
1064623164 10:17235249-17235271 TCTGAATCTCATCCTGCAGGCGG - Exonic
1065795901 10:29308207-29308229 CCTGAAGCCAATCCTGAAGCAGG - Intronic
1065947064 10:30614459-30614481 CCTGAAGCCAATCCTGAAGCAGG + Intronic
1067062505 10:43085085-43085107 TCTGGAGGCCAGCATGGAGCTGG + Intronic
1069844891 10:71364122-71364144 ACTAAAGCCCAGCCAGCAGCAGG + Intergenic
1069880365 10:71588925-71588947 TCCCAAGTGCAGCCTGCAGCAGG - Intronic
1071499467 10:86193204-86193226 TCTGAATCGCCACCTGCAGCTGG + Intronic
1071553476 10:86585128-86585150 TCAGAGGCTCAGCCTGCTGCTGG + Intergenic
1072306341 10:94111246-94111268 ACTGAATCCCACCCTGCAGCTGG - Intronic
1074573997 10:114651425-114651447 TCTGAGGCCCAGCAGGCTGCAGG - Intronic
1074662359 10:115675332-115675354 TCTGTTGCCCAGGCTGGAGCTGG - Intronic
1075941384 10:126393098-126393120 TCTGTTGCCCAGACTGGAGCTGG - Intergenic
1075957009 10:126532805-126532827 TCTGTTGCCCAGACTGGAGCTGG - Intronic
1076151786 10:128168546-128168568 TCTGAGGCCCAGCCTACATAAGG - Intergenic
1076238052 10:128881153-128881175 TCTCAAGCCTAGGCGGCAGCAGG + Intergenic
1076835694 10:133019987-133020009 TCTGACGCCCAGCCTGTGCCCGG - Intergenic
1077137149 11:1006185-1006207 GCTGTAGCCCAGCCTGCAGACGG + Intronic
1077423835 11:2465321-2465343 CCTGAGGCCCTGGCTGCAGCTGG + Intronic
1077493731 11:2874800-2874822 ACTGGAGCCCAGCTTGGAGCAGG - Intergenic
1077730300 11:4722964-4722986 TCTGCATCCCAGACTCCAGCCGG + Intronic
1078457455 11:11486293-11486315 TCAGAAGCCCATGCTGCATCAGG + Intronic
1080584374 11:33667968-33667990 CCTGCACCCCAGCCTGGAGCAGG + Exonic
1081153771 11:39664187-39664209 TCCTATGCCCAGCCTGCAGCGGG - Intergenic
1081850757 11:46273793-46273815 TCTGAAACCCACCCTGCTCCTGG + Intergenic
1083622284 11:64055180-64055202 CATGGAGCCCAGCCTGCAGGAGG + Intronic
1083856301 11:65394655-65394677 TCTGGAGCCCTGCCTCCTGCCGG + Intronic
1084066086 11:66705166-66705188 CCTGAAGCTCACCCTGGAGCAGG - Exonic
1084569801 11:69952372-69952394 TCTGCAGCCCAGCAGGCAGACGG + Intergenic
1084691829 11:70732056-70732078 TCTGAAGCCAAGACTTGAGCAGG - Intronic
1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG + Intronic
1087135955 11:94720362-94720384 TCAGAAGCCCAGACTGTGGCTGG + Intronic
1089126394 11:116179519-116179541 TCTGAACCATAGCCTTCAGCTGG - Intergenic
1089629911 11:119778095-119778117 TGTGCAGCTCAGCCTTCAGCAGG + Intergenic
1089638103 11:119829573-119829595 TCTGAAGCCCAGTCTTCCCCTGG - Intergenic
1089715039 11:120351304-120351326 TCTGTTGCCCAGGCTGCAGTAGG - Intronic
1090527905 11:127557105-127557127 TTTGAAGCCCAGCATGCATTAGG - Intergenic
1091428112 12:409173-409195 TCTGTTGCCCAGGCTGGAGCTGG - Intronic
1092291826 12:7164024-7164046 TCTGAAGCCCAGACAGCATGTGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093633466 12:21437553-21437575 TCCGAAACGCAGCCGGCAGCAGG + Intergenic
1093769983 12:23007066-23007088 TCTACAGCCCAGCATGCAGCAGG - Intergenic
1093896960 12:24584408-24584430 TCTGCAGCAGAGCCTGCAGCGGG + Intergenic
1093912794 12:24766452-24766474 ACTGGAGCCCAGGCTGCAGTGGG - Intergenic
1095580651 12:43793099-43793121 TCTCCTGCCCAGCCTGTAGCTGG + Intergenic
1096176936 12:49527909-49527931 TCTGAAGCCCAGACTGTAAGTGG + Intergenic
1096503445 12:52079384-52079406 GCAGCACCCCAGCCTGCAGCTGG + Intergenic
1098264731 12:68706822-68706844 TCTGCATCCCAGACTCCAGCTGG - Intronic
1101874619 12:108590069-108590091 TCTGACGCCCAGCCTGGAGCAGG - Exonic
1101920334 12:108927624-108927646 TCTGTTGCCCAGGCTGGAGCAGG + Intronic
1102031734 12:109743746-109743768 CCGGAAGCACAGCCTGCTGCGGG + Intronic
1102202503 12:111067381-111067403 TCTGAAACCCTGCCTCCAGGCGG - Intronic
1102532898 12:113559839-113559861 TCTGTTGCCCAGGCTGGAGCTGG + Intergenic
1103507092 12:121449025-121449047 TCTGGGGACCAGACTGCAGCGGG + Intronic
1104058171 12:125245968-125245990 TCACTAGCCCAGCCTGCATCTGG - Intronic
1104602324 12:130162267-130162289 CCTGCAGCCCAGCCTGCGGGGGG - Intergenic
1104605273 12:130183553-130183575 GCTGCAGCCCCACCTGCAGCTGG + Intergenic
1104617123 12:130279974-130279996 TCTGTCGCCCAGGCTGGAGCTGG - Intergenic
1104963345 12:132498392-132498414 CCTGTAGCTCAGCCTCCAGCCGG - Intronic
1105009648 12:132747070-132747092 TCTGAAGTGCAGCCAGCAGGCGG - Intronic
1106046725 13:26148910-26148932 TTTGAAGGCCAGCATGCAGGAGG + Intronic
1106533554 13:30617859-30617881 TTTCAGGCCCAGCGTGCAGCAGG + Exonic
1107628672 13:42319129-42319151 ATTGAAGCACAGCCTGCAGGAGG - Exonic
1108180240 13:47833555-47833577 TCTGCACACCAGCCAGCAGCAGG + Intergenic
1108688761 13:52844860-52844882 GCTGGAGCCCATCCTGCAGCGGG - Exonic
1111581098 13:90224767-90224789 AGTGCAGCCCAGGCTGCAGCAGG + Intergenic
1111965755 13:94859723-94859745 TCCTCAGCACAGCCTGCAGCAGG + Intergenic
1112341131 13:98553691-98553713 CCTTCAGCCCAGCCTGCAGCAGG - Intronic
1112822513 13:103353271-103353293 TCTGAAGCCAGCCCTGCAGCAGG + Intergenic
1112997911 13:105596863-105596885 TCTGAAGAAAAGCCTACAGCAGG + Intergenic
1114280635 14:21189964-21189986 TCTGTTGCCCAGGCTGGAGCGGG - Intergenic
1114390681 14:22304579-22304601 TCTGTACCCAAACCTGCAGCTGG + Intergenic
1114529325 14:23386026-23386048 CCTCCAGCTCAGCCTGCAGCAGG + Exonic
1114534736 14:23415727-23415749 CCTCCAGCTCAGCCTGCAGCAGG + Exonic
1115634674 14:35280093-35280115 TCTGTCGCCCAGGCTGGAGCTGG - Intronic
1115723827 14:36191524-36191546 GTTGATGCCCAGCCTTCAGCGGG - Intergenic
1116848691 14:49888002-49888024 TCTGTCGCCCAGGCTGGAGCGGG + Intergenic
1117127891 14:52650930-52650952 TATGAATACCAGCGTGCAGCTGG - Intronic
1118925423 14:70187149-70187171 TCAGAAACGCAGACTGCAGCAGG - Intronic
1119380148 14:74223287-74223309 TCAGAAACCCAGCCTGCGCCTGG - Intergenic
1122268563 14:100558028-100558050 GCTGGAGCCCCACCTGCAGCTGG - Intronic
1122283709 14:100638808-100638830 GCTGAGGCCCAGCAGGCAGCGGG - Intergenic
1122610027 14:102975949-102975971 CCTGGAGCACAGCCTGCAGATGG - Exonic
1122842600 14:104473674-104473696 CTTGAAGCCCAGCCTGAAGGTGG + Intergenic
1123786874 15:23683412-23683434 GCTGAAGCCCAGACTGCTGTGGG - Intergenic
1124055617 15:26238515-26238537 GGTGGAGCCCAGCCTGCTGCAGG + Intergenic
1124340709 15:28887620-28887642 TCTCCAGCCCAGGCTGCAGGGGG - Intronic
1124884838 15:33675856-33675878 TGTGTAGCCCTCCCTGCAGCAGG + Intronic
1125397815 15:39269447-39269469 TTTCAAGCACAGCCTGCAGGTGG + Intergenic
1125514216 15:40308888-40308910 TGTGTACCCCAGCCTGCAGCGGG + Intergenic
1125516247 15:40323044-40323066 TCCGAAGCCCAGCCTGGACTGGG + Intergenic
1127097473 15:55527215-55527237 CCTGTAGCACAGCCTGCAGTAGG - Intergenic
1127872751 15:63087203-63087225 ACTGAAGCCCAGACTGCACTTGG + Intergenic
1128023015 15:64409352-64409374 GCTGAAGCCCAGCTTTCAGAAGG + Intronic
1128607544 15:69047922-69047944 TCTGGAGGCCTGCCTGCAGGAGG - Intronic
1128842273 15:70859912-70859934 TCTGCATCCCAGACTCCAGCCGG - Intronic
1129323678 15:74788546-74788568 TCTGCAGCCCATCCTGCTGGAGG + Intronic
1129388605 15:75209235-75209257 GCTGAGGCCCAGCATGCAGTGGG - Intronic
1129741578 15:77992165-77992187 TGACAAGCACAGCCTGCAGCTGG + Intronic
1129844067 15:78760214-78760236 TGACAAGCACAGCCTGCAGCTGG - Intronic
1130597201 15:85256377-85256399 TGACAAGCACAGCCTGCAGCCGG - Intergenic
1131157211 15:90082492-90082514 TCTGAAGCCCAGCCTGGCATCGG - Intergenic
1131214936 15:90529325-90529347 TATGGAGCCAAGGCTGCAGCAGG + Intergenic
1132157354 15:99504934-99504956 TCTGAAGCCAGGCCTCCAGGAGG - Intergenic
1133062556 16:3184042-3184064 ACTGACGCCCTGCCAGCAGCAGG + Intergenic
1133777306 16:8907074-8907096 TCTCAAGCACAGCATGCACCCGG + Intronic
1134094579 16:11411124-11411146 TCTGTTCACCAGCCTGCAGCAGG - Intronic
1134240295 16:12501049-12501071 CCTGGAGCCTTGCCTGCAGCTGG - Intronic
1134913629 16:18050986-18051008 TCTATAGCCCAGCATGCAGGAGG - Intergenic
1135040463 16:19113975-19113997 TCTGGAGCCGAGCGTGGAGCTGG - Intronic
1135200328 16:20431652-20431674 TCTGAAGGTCAAACTGCAGCCGG + Intronic
1135218359 16:20591947-20591969 TCTGAAGGTCAAACTGCAGCCGG - Intergenic
1135309919 16:21397469-21397491 TCTGTGGCCCAGGCTGGAGCTGG - Intergenic
1135362813 16:21829570-21829592 TCTGTGGCCCAGGCTGGAGCTGG - Intergenic
1135424234 16:22324433-22324455 TCTGAGGCCCAGGCTGCTGCTGG + Intronic
1135508595 16:23060850-23060872 TTAGAAGTCCAGCCTGCAGGTGG - Intergenic
1136115423 16:28091465-28091487 TCTGGAGCCAGGCCTCCAGCTGG + Intergenic
1136306664 16:29376593-29376615 TCTGTGGCCCAGGCTGGAGCTGG - Intergenic
1138396572 16:56709227-56709249 GCTCAAGCTCAGGCTGCAGCTGG + Intronic
1139440481 16:66964165-66964187 GCTGAAGCCCAGGTTCCAGCAGG + Intronic
1139994068 16:70963513-70963535 TCTGAATCCCATCTTGCAGTTGG - Intronic
1140031774 16:71344881-71344903 TCTGAGGCCCACTTTGCAGCTGG + Intergenic
1140084374 16:71780852-71780874 TCTGTCGCCCAGGCTGGAGCGGG + Intronic
1141155337 16:81593211-81593233 TCAGCAGCACAGCCTGCAGCTGG - Intronic
1141698132 16:85630034-85630056 TCAGAAGGCCAGCCTGGGGCTGG + Intronic
1141966523 16:87448862-87448884 ACTGAAACCCATGCTGCAGCTGG + Intronic
1142021561 16:87786123-87786145 TCTGAAACCCAGCCTCTAGGAGG + Intergenic
1142031144 16:87839146-87839168 TCTGACTCCCAGCCCGCTGCCGG - Intronic
1142063879 16:88049210-88049232 TGGGAAGCCCAACCTGAAGCCGG - Intronic
1142167801 16:88602152-88602174 GGTGAGGCCCTGCCTGCAGCGGG - Intronic
1142738191 17:1914995-1915017 GCTGAAGATCAGCCTGCAGGGGG + Intergenic
1143347185 17:6258491-6258513 TCTGAATGCCACCCTGGAGCAGG + Intergenic
1143463820 17:7122105-7122127 TCTGTTGCCCAGTCTGCAGTAGG - Intergenic
1144186432 17:12800455-12800477 TCTGAGACCCAGGCTGCAGTGGG + Intronic
1144344749 17:14339768-14339790 TCTGGAGGCCAGCCTGGGGCTGG + Intronic
1145101783 17:20083213-20083235 TCTGAATGCCAGCCAGCTGCTGG + Intronic
1145813655 17:27780653-27780675 CCTAAAGCCCAGCCAGCAGCAGG - Intronic
1146255751 17:31390991-31391013 ACTGAACCCCAGCCTGGACCCGG - Intergenic
1147350034 17:39835192-39835214 TCTGCATCCCAGACTTCAGCTGG + Intronic
1147538843 17:41339732-41339754 TCTCCATCCCACCCTGCAGCTGG - Intergenic
1150624776 17:66834995-66835017 TCCCAAACCCCGCCTGCAGCTGG + Intergenic
1151355144 17:73553784-73553806 TCTGAGGCTCAGGCTGGAGCTGG - Intronic
1151395693 17:73821244-73821266 TCCAATGCCCAGCCTGCAGGTGG + Intergenic
1151517938 17:74608669-74608691 TCTGAATGGCAGCCTGGAGCTGG + Intergenic
1151554644 17:74840522-74840544 TGTGAAGCCGAGCCTGCTGCTGG - Intergenic
1152257537 17:79248900-79248922 TCTGCAGCTCAGCGGGCAGCTGG + Intronic
1152408917 17:80112249-80112271 CCTGCACCCCAGCCTGAAGCTGG + Intergenic
1152946314 17:83199376-83199398 CCTGAAGCCCACCCTCCCGCCGG + Intergenic
1153582022 18:6582842-6582864 TCTGAGGCAGAGGCTGCAGCAGG - Intronic
1156722264 18:40084584-40084606 TATGAACCCCAACCTGAAGCCGG - Intergenic
1157063528 18:44321015-44321037 TCTGCATCCCAGACTCCAGCTGG + Intergenic
1157854939 18:51096963-51096985 ACTCAAGACCAGCCTCCAGCTGG - Intergenic
1158972228 18:62679339-62679361 TCTCAAGTCCAGCCACCAGCTGG + Intergenic
1159216979 18:65405131-65405153 TCTGAAGCCTTGCCAGCATCTGG - Intergenic
1159444650 18:68526694-68526716 TATGGAGCCCAGCCTGCTGCAGG - Intergenic
1159552827 18:69913815-69913837 TCTGAAGCCCATCTTTCAGAGGG - Intronic
1160895761 19:1401198-1401220 TCTGCAGCCCACCCTCCCGCCGG - Intronic
1161750331 19:6091410-6091432 TCTGTCGCCCAGGCTGCAGTGGG - Intronic
1162228614 19:9245946-9245968 TCTGGAGCCCAGACTGTTGCTGG + Intergenic
1162723111 19:12674129-12674151 TCTGCAGCCCAGCCTGACCCCGG - Intronic
1164005788 19:21147458-21147480 TCTGTTGCCCAGGCTGGAGCTGG - Intronic
1164596077 19:29531187-29531209 TCTGAGGCCCAGCTTGGAGCAGG - Intronic
1164861542 19:31565751-31565773 TCTGGAGCACAGCCTGCAACTGG - Intergenic
1165477579 19:36040093-36040115 GCTGCAGCCAGGCCTGCAGCCGG + Exonic
1167199123 19:48051913-48051935 TCTGTCGCCCAGCCTGGAGTGGG + Intronic
1168121835 19:54256116-54256138 TCTGAACCTCCACCTGCAGCTGG + Exonic
924982826 2:238637-238659 TCCAAAGCCAAGCCAGCAGCAGG + Intronic
925171226 2:1751359-1751381 TCTGAAGACCAGCTCACAGCAGG + Intergenic
925276028 2:2649088-2649110 GGAGAAGCACAGCCTGCAGCAGG - Intergenic
925330774 2:3056893-3056915 TCTGAACCCCTGCCTGCTGAGGG - Intergenic
926116573 2:10217453-10217475 GCTGAACCCCAGCCTGGAACTGG - Intergenic
926281739 2:11454382-11454404 TCTGTTGCCCAGGCTGGAGCTGG + Intronic
926795445 2:16615468-16615490 TACAAAGCCCAGCCTGCAGTGGG - Intronic
927499253 2:23571308-23571330 TCTCCAGCTCTGCCTGCAGCTGG - Intronic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
929387282 2:41424461-41424483 TCTGTTGCCCAGGCTGGAGCTGG + Intergenic
930388138 2:50723716-50723738 TCTGCAGCCCAGGCTGCATTAGG - Intronic
930449080 2:51511339-51511361 CCTGCAGCAGAGCCTGCAGCAGG + Intergenic
931826932 2:66010144-66010166 TCTGAGGCCCCGCCTGCACAGGG - Intergenic
932571111 2:72938787-72938809 TCTGAAGCCCAGGTTGGAGGTGG - Intergenic
934853068 2:97713410-97713432 TCTCAGTCCCATCCTGCAGCTGG + Intergenic
934973767 2:98786087-98786109 TCTGAAGCCCAGCCTCCCATGGG + Intergenic
935880146 2:107557245-107557267 GCTGTAACCCAGCCTGCAGAGGG - Intergenic
935894444 2:107719628-107719650 TCTGAACCCCAGGCTCCAGAAGG + Intergenic
936786994 2:116105483-116105505 TCTGAAGCTCTGCTGGCAGCTGG + Intergenic
937344804 2:121118994-121119016 GCTGTGGCCCAGCCTGCACCAGG + Intergenic
937991167 2:127663350-127663372 GCGGGAGCCCAGCATGCAGCAGG + Intronic
938540001 2:132278087-132278109 TCTGACGCCCAGGCTGAAGCTGG - Intergenic
939057772 2:137384135-137384157 TTTGAAGCCCACCTTGGAGCAGG - Intronic
941728580 2:168890460-168890482 TCAGAAGGCCAGCCTGCGCCTGG - Intronic
942558677 2:177198301-177198323 TCTGCATCCCAGACTCCAGCCGG - Intergenic
943393957 2:187308696-187308718 TCTGTAGCCCAGACCTCAGCAGG + Intergenic
943743358 2:191435396-191435418 TATGAATCCCAGCCCACAGCTGG + Intergenic
945057989 2:205884804-205884826 ACTGAAGCCCCGCATTCAGCTGG + Intergenic
946199865 2:218065222-218065244 TCTGATGCCCTGCCTGCAGTGGG - Intronic
948486965 2:238287603-238287625 TCTGAAGCTCATCCTGCCCCAGG + Intronic
948706035 2:239792974-239792996 AGTGGAGCCCAGCCTGGAGCGGG - Intronic
948788752 2:240366287-240366309 TCAGAGGCAGAGCCTGCAGCAGG + Intergenic
948894667 2:240922535-240922557 TCTCCAGCCGGGCCTGCAGCTGG - Exonic
949072549 2:242034490-242034512 CCTCAGGCCCAGCCTGCTGCTGG - Intergenic
1169878141 20:10319923-10319945 TCAGAAGAGGAGCCTGCAGCAGG - Intergenic
1170839955 20:19916563-19916585 TCTGTCGCCCAGGCTGGAGCTGG - Intronic
1171034791 20:21706127-21706149 TCTGATCCCCAGCCTTCAGGGGG + Intronic
1171246507 20:23614247-23614269 ACCGAAGGCCAGCCTGCAGAAGG - Intergenic
1171465234 20:25323286-25323308 TCTGCAGCCCCTCCAGCAGCAGG - Intronic
1171868929 20:30511105-30511127 TCTGATGCCCAGGCTGGAGCTGG - Intergenic
1172511620 20:35504798-35504820 TTTAGAGCCCAGGCTGCAGCGGG + Exonic
1172567746 20:35944189-35944211 TCTGGACCCCAGCATCCAGCAGG - Intronic
1173250886 20:41363707-41363729 TCTGAGGCTCAGGCTCCAGCTGG + Exonic
1173653443 20:44682493-44682515 TCTGGAGCACACCCTCCAGCTGG - Intergenic
1174523603 20:51154244-51154266 TCTCAAGCCAAGCCAGCACCTGG - Intergenic
1174565875 20:51464110-51464132 TCTGAAACCCAGGCAGCAGTAGG - Intronic
1175238900 20:57532139-57532161 TCTGAAGCCTGACCAGCAGCTGG + Intergenic
1175488227 20:59360773-59360795 TCTGTGGCACAGGCTGCAGCAGG + Intergenic
1175601074 20:60273583-60273605 CCTGAAGCCCAGCCAGCAGTGGG - Intergenic
1175907197 20:62386748-62386770 TCTCTAGCCCGGCCGGCAGCGGG + Intergenic
1176179562 20:63742938-63742960 TCTGGTGCACAGCCTGCCGCTGG + Exonic
1178323960 21:31628393-31628415 CCTGAAGCCCATGTTGCAGCAGG - Intergenic
1179430940 21:41320693-41320715 TCTGGAGTGCAGCATGCAGCTGG - Intronic
1179799435 21:43804020-43804042 ACTGAAACTCTGCCTGCAGCAGG + Exonic
1179883025 21:44301233-44301255 TCTGAACCCCGGCCTGCAGAGGG + Intronic
1182077627 22:27505710-27505732 ACTGATCCCCTGCCTGCAGCAGG - Intergenic
1183150000 22:36029227-36029249 TCTCAAGCCCCGCCTGCTCCAGG - Intergenic
1183960665 22:41410183-41410205 TCTGAAGCCCAGATGGCAGGAGG - Intergenic
1184165354 22:42724110-42724132 TCTGAAGCTCTCCCTGCAGTCGG - Intergenic
1185176810 22:49332363-49332385 TCTGGTGCCCAGGCTGTAGCTGG + Intergenic
1185239773 22:49736242-49736264 TCTGAAGCCAGGCCTGATGCCGG + Intergenic
1185270098 22:49925803-49925825 TCTGAAGCTCAGACCTCAGCGGG + Intronic
949299993 3:2572501-2572523 TCAGAAGTCCAGCATGCAGCGGG + Intronic
949414095 3:3798626-3798648 TCTGAAGCCCTGCTTCCGGCTGG + Intronic
949978025 3:9478313-9478335 TGTGAAGGCAAACCTGCAGCAGG + Intronic
950055906 3:10024198-10024220 TCTGTTGCCCAGGCTGAAGCTGG - Intergenic
950577223 3:13839381-13839403 CCTGAAGCCCAGCCCGTAACAGG + Intronic
952611513 3:35215932-35215954 TCTGCATCCCAGACTCCAGCCGG + Intergenic
953607096 3:44419303-44419325 ATACAAGCCCAGCCTGCAGCAGG - Intergenic
954334903 3:49910561-49910583 TGTGAGCGCCAGCCTGCAGCAGG - Exonic
955839449 3:63096602-63096624 TCTGCATCCCAGACTCCAGCCGG + Intergenic
955869314 3:63419732-63419754 TCTTAAGCACAGACTGCAGAAGG + Intronic
960439674 3:117671317-117671339 TGTAAAGCCCAGTCAGCAGCTGG - Intergenic
960963498 3:123089114-123089136 TCTGGGGCCCAGCCAGAAGCTGG + Intronic
960974543 3:123161662-123161684 TCTGGAGTCCAGCCTGCCTCTGG - Intronic
961190595 3:124958038-124958060 TTTGCAGCCCTCCCTGCAGCTGG + Intergenic
961507084 3:127377261-127377283 TCTGTCGCCCAGGCTGGAGCTGG + Intergenic
961918649 3:130403403-130403425 TCTGAAGCCCCTCTTGCAGAAGG - Intronic
962713065 3:138103623-138103645 TCTGCAGCCGTGCCTCCAGCTGG + Exonic
964079644 3:152737691-152737713 TCAGTAGCCCATCCTGCAGTTGG + Intergenic
964411388 3:156401315-156401337 GGTGAAACCCAGCTTGCAGCTGG - Intronic
964802270 3:160568994-160569016 TCTGCATCCCAGACTCCAGCTGG - Intergenic
965605810 3:170496632-170496654 TCTGCATCCCAGACTCCAGCCGG - Intronic
966543760 3:181120778-181120800 TCTGTTGCCCAGGCTGCAGTGGG + Intergenic
967248251 3:187510622-187510644 TCTGTAGCCCAGGCTGGAGCTGG - Intergenic
968799265 4:2731591-2731613 TCTCAAGTGCAGCCTGTAGCAGG + Intronic
968949469 4:3683190-3683212 TCCGAACCCCAGCCAGCTGCAGG + Intergenic
971860023 4:32090238-32090260 TCTCAATACCATCCTGCAGCTGG - Intergenic
971950636 4:33340663-33340685 TCTCAACTGCAGCCTGCAGCAGG + Intergenic
972448945 4:39176892-39176914 TCTGAAGCCCAGGCTGGAGTGGG - Intergenic
972814663 4:42630745-42630767 TCTGAAGCCCACCATGCAATGGG + Intronic
974538067 4:63195275-63195297 TCTGAAGACGATGCTGCAGCTGG - Intergenic
974751935 4:66153591-66153613 ACTGAAGTCCAGCCTACAGCAGG + Intergenic
975654402 4:76627234-76627256 TCTGGAGAGCAGCCTGCAGGGGG + Intronic
975665753 4:76733301-76733323 TCTGCATCCCAGCCTCCAGAGGG + Intronic
980998095 4:139801003-139801025 TCTGAAGCCCAACATGCACCAGG - Intronic
981459495 4:144996486-144996508 TCTCAACAACAGCCTGCAGCTGG - Intronic
982343494 4:154330972-154330994 TGTGCAGCTCAGGCTGCAGCTGG + Intronic
985068138 4:186143580-186143602 TCTGTCGCCCAGCCTGGAGTGGG + Intronic
985768446 5:1794427-1794449 CCACCAGCCCAGCCTGCAGCGGG - Intergenic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
987843747 5:23255069-23255091 TCTGGTGATCAGCCTGCAGCTGG + Intergenic
989678221 5:43997787-43997809 AGTGATGCCCTGCCTGCAGCAGG - Intergenic
990900460 5:60743791-60743813 TCTGCATCCCAGACTCCAGCCGG + Intergenic
991255782 5:64612555-64612577 TCTGAAGCTCAGCTTTCAGTAGG - Intergenic
991585449 5:68197033-68197055 TCAGAAGCCCAGTCAGCAGCAGG + Intronic
993885722 5:93412733-93412755 GCTGGATCCCAGCCTACAGCTGG - Intergenic
995841017 5:116443330-116443352 GCTCAAACCCAGCCTGGAGCAGG - Intergenic
996432879 5:123401122-123401144 TCTGCATCCCAGACTCCAGCCGG + Intronic
997258044 5:132444245-132444267 TGTGAAGCCCAGCCGGCAAGGGG - Intronic
997615353 5:135242388-135242410 CATGAAGCCCAGACTGCAGGAGG - Intronic
998797420 5:145835051-145835073 CCTGAAGCAAAGCCCGCAGCTGG + Intronic
999772560 5:154786546-154786568 TCCGAGGCCCAGACTGTAGCAGG - Intronic
1000501314 5:162054343-162054365 TCTGTTGCCCAGGCTGTAGCTGG - Intergenic
1000588325 5:163127426-163127448 TCTGAAGCCCAAACTACTGCTGG - Intergenic
1000603658 5:163304185-163304207 TCTGGTGCCCAGGCTGGAGCTGG - Intergenic
1001057450 5:168461466-168461488 TCTGAGCACCAGCCTGAAGCAGG + Intronic
1001460683 5:171910593-171910615 CCTGAAGCCCATGTTGCAGCGGG - Exonic
1001915851 5:175559431-175559453 CCTGAGTCCCAGCCTGTAGCTGG + Intergenic
1002519051 5:179780508-179780530 TCTGCAGCCCTGCCTCCAGCAGG - Intronic
1002519622 5:179784397-179784419 CCTGAAGCCCAGCTTGCAGCAGG + Intronic
1002702807 5:181137945-181137967 GCTTAAGCCCAGCCAGCATCTGG - Intergenic
1002772516 6:301815-301837 TCTGGAGCCCGGCTTGCTGCAGG - Intronic
1003690916 6:8352811-8352833 TCTGAGGCTCAGCTTCCAGCTGG + Intergenic
1004683746 6:17921754-17921776 TCTGAAGACTAGCCTGCTTCTGG + Intronic
1005586319 6:27279809-27279831 ACTGGAGCCCAGCCTGCACCTGG + Intergenic
1006451755 6:34109439-34109461 TCTGGAGCAGAGCCTGCAGAGGG + Intronic
1007247837 6:40475160-40475182 GCTGGTGCCCAGGCTGCAGCTGG - Intronic
1007588021 6:43004050-43004072 TCTGTCGCCCAGGCTGGAGCTGG + Intronic
1007614070 6:43170456-43170478 CCCCAAGTCCAGCCTGCAGCTGG + Intergenic
1007732369 6:43954879-43954901 CCAGAAGCCCAGGCTGCAGAGGG - Intergenic
1008592581 6:53009126-53009148 GCTAAAGCCCTGGCTGCAGCAGG - Intronic
1009666890 6:66693499-66693521 TCTGCAACCCAGCCCACAGCTGG + Intergenic
1011515078 6:88144923-88144945 CCTGAACCCCAGCCAGCAGCTGG - Exonic
1012365396 6:98433002-98433024 TCTGATGCCCAGCCTGCCATAGG + Intergenic
1012433785 6:99193260-99193282 CCTGGAGCCCAGGCTTCAGCTGG + Intergenic
1012472633 6:99588995-99589017 TCTGGTTCCCAGCCTGGAGCAGG - Intergenic
1015228305 6:130883919-130883941 TCTGAGGCCCAGCATGGAGAAGG - Intronic
1015539163 6:134297202-134297224 TCTGTATCCCAGACTCCAGCCGG + Intronic
1018733988 6:166673634-166673656 TCCAAAGCGCAGCCTGCAGGCGG + Intronic
1020613420 7:10428760-10428782 TCTAAGGCCAAGGCTGCAGCTGG - Intergenic
1020844145 7:13261517-13261539 CCTGTATCCCAGCCTGTAGCTGG + Intergenic
1021838862 7:24706304-24706326 GCTGAAGCCCCGGCAGCAGCAGG - Exonic
1023586981 7:41741286-41741308 TTTGTAGTCCAGTCTGCAGCAGG + Intergenic
1023981348 7:45072472-45072494 ACTTCAGCCCAGCGTGCAGCAGG + Intronic
1026335030 7:69386830-69386852 TCTGCAGCCCCTCTTGCAGCTGG + Intergenic
1029105534 7:98172127-98172149 CCTGAAGCCCACCCTTCAGCTGG - Intronic
1031173887 7:118324923-118324945 TCTCATGCTCAGCCTGCAGCTGG + Intergenic
1032012749 7:128357546-128357568 TGTCCAGCCCAGCGTGCAGCAGG - Intronic
1034355908 7:150450738-150450760 TCTGAAGCTCAGCCTGGCACCGG + Exonic
1034445806 7:151113711-151113733 TCTGAAGCCCAGCCAGTTTCCGG - Intronic
1034947726 7:155274287-155274309 TGAGAAGCCCAGCCGGCAGCAGG + Intergenic
1035601832 8:901859-901881 TCTCATGCCCAGCCTGCAAACGG - Intergenic
1035604685 8:921962-921984 TCAGAAATGCAGCCTGCAGCCGG - Intergenic
1036604856 8:10295743-10295765 TCTGCAGCCCAGGCAGCAGTGGG + Intronic
1037930075 8:22874072-22874094 TGTGGAGCCCATCCCGCAGCTGG + Intronic
1038037031 8:23695131-23695153 TCTGTATTCCAGCCAGCAGCAGG + Intergenic
1038707657 8:29909949-29909971 TCTCAACAGCAGCCTGCAGCAGG - Intergenic
1039804420 8:40986395-40986417 CCTGGAGCCCAGGCTGCAGGAGG - Intergenic
1039833146 8:41233696-41233718 TCCGAAGACCTGCCTGCAGACGG - Intergenic
1040024211 8:42766773-42766795 TATTAAGCCCAGCATGCATCAGG - Intronic
1041486021 8:58377056-58377078 TCTGTTGCCCAGGCTGCAGTGGG - Intergenic
1041781172 8:61579419-61579441 TCTGCATCCCAGACTTCAGCCGG - Intronic
1044199028 8:89412847-89412869 TCTGCATCCCAGACTCCAGCTGG + Intergenic
1044553459 8:93537039-93537061 TCTGATCCCCAGGCTGCAGGTGG + Intergenic
1044932353 8:97262012-97262034 TCTGAAACCCAGACTGCTCCTGG + Intergenic
1045189427 8:99868339-99868361 TCTGAGGCACAGGCTTCAGCAGG + Exonic
1045508828 8:102797690-102797712 TCTGAAGTCCAGGTGGCAGCAGG - Intergenic
1047556682 8:125939517-125939539 TCTGCAGACCAGGCTGCAGTTGG + Intergenic
1048897140 8:139002093-139002115 GATGCAGCCCAGCCTGCAACAGG - Intergenic
1048926050 8:139272394-139272416 CCTGAAGCTGAGCCTGCAGTGGG - Intergenic
1049331739 8:142058184-142058206 TCTTAGGCCCAGCCCGCAACTGG - Intergenic
1049487867 8:142875818-142875840 TCGGAACCCCAACGTGCAGCAGG - Exonic
1049581686 8:143414570-143414592 TATGTTGCCCAGGCTGCAGCAGG + Intergenic
1050143318 9:2539065-2539087 ACTGCAGCCCAGCCTACAGCAGG - Intergenic
1050151550 9:2622753-2622775 TCTGAAGCCCGGCCGGCCCCTGG - Intronic
1050772900 9:9225924-9225946 TCACAAGCCCAGACAGCAGCAGG + Intronic
1050828731 9:9984374-9984396 TCTGAACCCCAGCCTTGAGAAGG - Intronic
1050828832 9:9985183-9985205 TCTGAACCCCAGCCTTGAGAAGG + Intronic
1052839216 9:33277153-33277175 TCTGTTGCCCAGGCTGCAGTGGG - Intronic
1056834495 9:89943555-89943577 TCTGGAGCCCTGACTGCAGGTGG - Intergenic
1057041145 9:91848365-91848387 TCTGATGCCCTGCCTCCAGATGG - Intronic
1057206176 9:93174091-93174113 TCTGTCGCCCAGGCTGGAGCTGG + Intergenic
1058465391 9:105221936-105221958 TCTGAACCCCAGCCTGCAGTAGG - Intergenic
1058764542 9:108168622-108168644 TCTGTAGCCCTGGCAGCAGCAGG - Intergenic
1059230977 9:112721330-112721352 TCTGAAGGCCTGCCTGGGGCTGG - Intergenic
1059706220 9:116825986-116826008 TCTCAATAGCAGCCTGCAGCAGG - Intronic
1061105075 9:128523714-128523736 GCTGCAGCTCAGCCAGCAGCTGG + Exonic
1061406112 9:130393893-130393915 GCAGGGGCCCAGCCTGCAGCTGG + Intronic
1061444726 9:130631388-130631410 TCTGCAGCGCAGCCTGCTGTGGG + Intronic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1186399121 X:9240745-9240767 GCTGCACCCCAGCCTGCAGGGGG - Intergenic
1186458427 X:9729138-9729160 TCTGGAGCCCAGACACCAGCTGG + Intronic
1187013962 X:15307987-15308009 TCTCCAGCCCACCCAGCAGCTGG + Intronic
1189499265 X:41540147-41540169 TCTGATGCCCAGACGGCCGCTGG + Intronic
1190339544 X:49286031-49286053 CCTGGAGCCCAGTCAGCAGCAGG + Exonic
1192145621 X:68680360-68680382 ACACAAGCCCAGCCTGGAGCTGG - Intronic
1192731382 X:73805587-73805609 TCAGAAGCTCATGCTGCAGCAGG + Intergenic
1194665000 X:96667704-96667726 TCTGAAGTCCAGGCATCAGCAGG + Intergenic
1198268597 X:135033013-135033035 ACAGGAGCCCAGCTTGCAGCTGG - Exonic
1199564720 X:149203470-149203492 TCTGTACCCCATACTGCAGCTGG + Intergenic
1199927275 X:152480637-152480659 GCTGGAGGCCACCCTGCAGCGGG + Intergenic