ID: 908037891

View in Genome Browser
Species Human (GRCh38)
Location 1:60075232-60075254
Sequence GCTTGAAGTCAGATAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908037891_908037893 14 Left 908037891 1:60075232-60075254 CCTTCCACTATCTGACTTCAAGC 0: 1
1: 0
2: 0
3: 23
4: 303
Right 908037893 1:60075269-60075291 GATCTCCCACTACTTCTCCTAGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908037891 Original CRISPR GCTTGAAGTCAGATAGTGGA AGG (reversed) Intergenic
900508661 1:3044891-3044913 ACTTGAAGGTAGAGAGTGGAAGG - Intergenic
900778503 1:4601806-4601828 GTTTGAAGTCAGAAAGGAGAAGG - Intergenic
901124907 1:6922425-6922447 TGTTGCAGTCAGATAGTGGCTGG + Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901478760 1:9509445-9509467 ACTTGAAGTCTGATATTTGAGGG - Intergenic
903441394 1:23390590-23390612 GCTGGAGGTCAGATTGTGGAAGG + Intronic
907670405 1:56469591-56469613 ACTTGAACTCAGGTGGTGGAGGG + Intergenic
908037891 1:60075232-60075254 GCTTGAAGTCAGATAGTGGAAGG - Intergenic
908428919 1:64036845-64036867 GGTTGCAGTCAGATGGTGGCTGG + Intronic
908924771 1:69241186-69241208 GTTTGATGTTAGATAATGGAGGG - Intergenic
909465490 1:75969464-75969486 GCTTGTAGTCAAATAGGGGAAGG + Intergenic
909534954 1:76726191-76726213 GTTTTAAGTAAGATTGTGGATGG - Intergenic
910002504 1:82356789-82356811 GCTTGCAGAGAGGTAGTGGAGGG + Intergenic
910761884 1:90741090-90741112 GCTTGCAGTGACACAGTGGATGG - Intergenic
910958286 1:92731621-92731643 TCTTGAAATCAGATAGTGTTAGG - Intronic
911548667 1:99253067-99253089 GCTTGAAATCAGATACTGATTGG + Intergenic
912467059 1:109881622-109881644 CCTTGAAGTCAGATAGCCAAGGG - Intergenic
914452825 1:147807804-147807826 GCTTGTAGTCACACAGAGGAGGG - Intergenic
916082172 1:161240937-161240959 GCTGGAGCTAAGATAGTGGAAGG + Intergenic
916105861 1:161431653-161431675 ACTTGGAGTCAGATATTTGAGGG + Intergenic
918728366 1:187955401-187955423 GCTTGCAGTCAGATGGTCAAGGG - Intergenic
919284098 1:195531195-195531217 ACTTGAAGTCAGGTATTGTAAGG - Intergenic
919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG + Intronic
919968064 1:202549253-202549275 GCTTGAAGTCTGAAACTGGGTGG - Intronic
920130279 1:203726826-203726848 GCTTGAGGTGAGGAAGTGGATGG - Intronic
920534602 1:206729429-206729451 GATTGAATGCAGATACTGGATGG - Exonic
921199950 1:212794689-212794711 TCTTGAAGTCTGAAAGAGGAAGG + Intronic
921423018 1:214970667-214970689 GCTTAAACTCAGATAATGGGAGG - Intergenic
924018102 1:239749728-239749750 GCTGGAAGTCAGTTTGTGCAAGG + Intronic
1064886105 10:20114247-20114269 GGCTGAGGTCAGATGGTGGAAGG - Intronic
1065142835 10:22736220-22736242 GCTTTAAGTCAGATAGGAGAGGG - Intergenic
1065525324 10:26614141-26614163 GCTTGAACCCAGAAGGTGGATGG + Intergenic
1065875686 10:29995516-29995538 GCTTGAAAGCAGATGGGGGATGG + Intergenic
1066436870 10:35403762-35403784 GCTTGCTGAGAGATAGTGGAGGG + Intronic
1067256157 10:44644351-44644373 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1068339574 10:55684490-55684512 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1069145303 10:64885516-64885538 GCTTGGAGATAGAAAGTGGAAGG - Intergenic
1070167185 10:73907611-73907633 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1070469077 10:76760010-76760032 GGTTGAAGGAAGTTAGTGGATGG - Intergenic
1071004471 10:80866608-80866630 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1071217644 10:83426585-83426607 GGTTGAATTCTGATTGTGGATGG - Intergenic
1071237252 10:83663540-83663562 GCTAGGATTCAGATACTGGAAGG + Intergenic
1072012283 10:91313072-91313094 GGTTGCAGTCAGATATTGGCTGG - Intergenic
1072346775 10:94515428-94515450 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1072777877 10:98218992-98219014 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1073933861 10:108606806-108606828 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1075140140 10:119826064-119826086 GCTCAAATTCAGATAGTGGGGGG - Intronic
1076400201 10:130178335-130178357 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1077395609 11:2319448-2319470 ACTTGAAGTCAGGAGGTGGAGGG + Intergenic
1078156741 11:8806234-8806256 GTTGGAAATCACATAGTGGATGG - Intronic
1078789329 11:14526913-14526935 GCTTGCTGAGAGATAGTGGAGGG - Intronic
1079165345 11:18035826-18035848 GCTTACAGTCTGATAGTGAAGGG - Intronic
1079537127 11:21527771-21527793 GCTTGGAGTCTGATATTTGAGGG + Intronic
1079680392 11:23289568-23289590 GCTTGAAGTCAGAGAGTCCTAGG - Intergenic
1080122961 11:28698481-28698503 GCATGAATTCAGATTGTTGATGG + Intergenic
1081186812 11:40053083-40053105 TCTAGAAGTCAGAAAGTAGATGG - Intergenic
1082650247 11:55782041-55782063 GTTTGAAGTAAGATAATGTAAGG - Intergenic
1082807465 11:57460104-57460126 GCTTGAGGTCTGGGAGTGGAAGG + Intergenic
1083930880 11:65844210-65844232 ACTGGAAATCAGATAGTGCAAGG - Intronic
1085655078 11:78306698-78306720 TCTTGAAGGCAGAGAGTGAAAGG + Intronic
1085963025 11:81485489-81485511 GCTTCTAGTCAGATAGTAAATGG - Intergenic
1085988311 11:81810496-81810518 GCTTGCTGAGAGATAGTGGAGGG - Intergenic
1086635584 11:89079405-89079427 TCTTGAAGTCAGATAGATGGAGG + Intergenic
1087135209 11:94709676-94709698 AGTTGCAGTCAGATAGTGGTGGG - Intronic
1088449669 11:109967962-109967984 ACTTGGAGTCTGATAGTTGAGGG - Intergenic
1089546938 11:119235008-119235030 GGTTGAAGTCAGATTGTAAAGGG + Intronic
1089739030 11:120569394-120569416 GGATCAAGTCAGATAATGGATGG - Intronic
1090980557 11:131717152-131717174 TCTTCAAATCAGATAGTGGTAGG + Intronic
1091386808 12:101164-101186 GCTTGCAGGCTGAGAGTGGATGG - Intronic
1091921992 12:4312114-4312136 GCTTGATGTCTGAAGGTGGAGGG - Intergenic
1092625288 12:10320293-10320315 GCTTGAAAACAGGCAGTGGATGG + Intergenic
1093944559 12:25092480-25092502 GCTTGAACTCAGGAGGTGGAGGG + Intronic
1094030123 12:26002348-26002370 GCTTGAACCCAGAGGGTGGAGGG + Intronic
1095424185 12:42057393-42057415 GCTTTTAGTCAGATGGAGGAGGG + Intergenic
1095485961 12:42684953-42684975 GTTTGCTGTCAGATAGTGGCTGG - Intergenic
1095669533 12:44842196-44842218 TCTTGAAATCAGGTAGTGTAAGG - Intronic
1097379333 12:58876389-58876411 TTTTGAAGTCATATGGTGGAAGG - Intronic
1097541883 12:60953403-60953425 GCTTGCTGAGAGATAGTGGAGGG + Intergenic
1097875086 12:64635864-64635886 GTTTGAAGTCAAATAGTAGAAGG + Intronic
1098326405 12:69307859-69307881 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1099454895 12:82851345-82851367 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1100483934 12:95006476-95006498 GTTTGAAGTCAGGAAGTGGAAGG + Intergenic
1101519195 12:105465962-105465984 GCTTTAGGTCAGATAGCGCATGG + Intergenic
1104163718 12:126205786-126205808 GTTTGAAGTGAGCTTGTGGATGG - Intergenic
1108303633 13:49107695-49107717 GGTTGAAGTCAGGTTGGGGAGGG + Intronic
1109536113 13:63722046-63722068 ACTTGAAGTCAGATGTTTGAGGG - Intergenic
1109539987 13:63764240-63764262 ACTTGAAGTCAGATGTTTGAGGG + Intergenic
1111198864 13:84907496-84907518 GCTTGAAGTCTGATGTTGGAGGG - Intergenic
1111947127 13:94677748-94677770 GATTGAGGCCAGATAGTGGAAGG + Intergenic
1112889059 13:104209736-104209758 GCTTGCTGAGAGATAGTGGAGGG + Intergenic
1113519171 13:110926529-110926551 ACTTGGAGTCCGATATTGGAGGG - Intergenic
1113993720 14:16050297-16050319 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1114339875 14:21731793-21731815 GCTTGGAGCAAGAGAGTGGATGG - Intergenic
1114577271 14:23726317-23726339 ATTTGAAGTCAGAAAGAGGAGGG - Intergenic
1115303306 14:31908762-31908784 GCTTGAAGTCAGGTAATGTGAGG + Intergenic
1115877469 14:37876562-37876584 GCTGGATGGCAGAGAGTGGAGGG - Intronic
1116808952 14:49520864-49520886 GTTTGCAGTCAGATGGTGGGTGG + Intergenic
1117973873 14:61279804-61279826 TCTTCAAGTCTGAGAGTGGAAGG - Exonic
1118917593 14:70120973-70120995 ACTTGATGTAAAATAGTGGAAGG + Intronic
1120153227 14:81061633-81061655 GCTTGAAGGCAGAGGGTGGGAGG + Intronic
1120491653 14:85185748-85185770 GTATGAAGTCAAGTAGTGGAGGG - Intergenic
1123194579 14:106604301-106604323 GGTAGAAGTCAGACAATGGATGG - Intergenic
1124043762 15:26128699-26128721 GCCTGAAGTCAGAGCTTGGAGGG - Intergenic
1125496176 15:40196400-40196422 GTTTGAAGTCAGGTAATGTAAGG + Intronic
1125703918 15:41714492-41714514 GCCAGTAGTCAGATACTGGATGG + Intronic
1125842964 15:42822617-42822639 GGTTGAAGTCAGATTAAGGAAGG + Intronic
1126874456 15:53024970-53024992 GCTTGGAGTCTGATATTTGAGGG + Intergenic
1129059373 15:72848669-72848691 GCTTGAACTCAAGAAGTGGAGGG - Intergenic
1135160821 16:20094490-20094512 TCTTGTAGTCAGATTGGGGAGGG + Intergenic
1135922304 16:26662186-26662208 GTTTGAAGTCAGATAGTGTGAGG + Intergenic
1137055033 16:35741277-35741299 GCTTGTTGAGAGATAGTGGAGGG + Intergenic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1140822947 16:78679984-78680006 GCATGGAGTCAGTTAGTGGTAGG - Intronic
1142747994 17:1969905-1969927 GGTTGCAGTCAGATGGTGGCAGG + Intronic
1144016360 17:11200118-11200140 TCTTGGAGTCAGAAAGAGGATGG + Intergenic
1144139730 17:12336800-12336822 GCTTGGAGGCAGATAGCGCAGGG - Intergenic
1144606988 17:16675665-16675687 GCTGGAAATCACTTAGTGGAAGG - Intergenic
1145217657 17:21064309-21064331 GATTAAAGTCAGAAAGTGGCTGG + Intergenic
1147343688 17:39772185-39772207 AGTTGAAGACAGATTGTGGAGGG + Intronic
1147706107 17:42425852-42425874 GCTTGAACCCAGGAAGTGGAGGG - Intergenic
1149023075 17:51992521-51992543 GCCTGAAATCAGAGAATGGAAGG - Intronic
1149114202 17:53072052-53072074 ACTTGAATTCATGTAGTGGAGGG - Intergenic
1149657499 17:58318076-58318098 GCTTGCAGGCAGGCAGTGGAGGG + Intronic
1149703783 17:58677034-58677056 GCTTGAACTCAGGAGGTGGAGGG + Intronic
1150767509 17:68013884-68013906 ACTTGGAGTCAGATATTCGAGGG + Intergenic
1151999517 17:77636722-77636744 GCTTCAAGCCAGAAACTGGAAGG - Intergenic
1152929913 17:83104190-83104212 GCTTGCAGGCAGGAAGTGGAGGG - Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155433273 18:25784322-25784344 GCTTGAAACCAGAAACTGGAGGG + Intergenic
1156179031 18:34581701-34581723 GCTTGAAGCCAGGAGGTGGAGGG - Intronic
1159397295 18:67877018-67877040 GCTTAGAGTCAGAAAGTGGCAGG - Intergenic
1159660507 18:71090298-71090320 GTTTGAAGTCAGATAGTATGAGG + Intergenic
1163049345 19:14670164-14670186 GATTATAGTCAGTTAGTGGATGG + Intronic
1163462231 19:17445922-17445944 GATAGATATCAGATAGTGGATGG - Intronic
1163513611 19:17749939-17749961 CCTGGAAGCCAGATCGTGGAAGG + Intronic
1164803930 19:31101646-31101668 GCATAAAGTCAGAAATTGGAGGG + Intergenic
1165709043 19:37996776-37996798 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1166839730 19:45689626-45689648 GCTTGAACTCAGAGAGTCGGAGG + Intronic
1166883287 19:45941906-45941928 GCTTGGAGTGAGATCCTGGAGGG - Intronic
1166935645 19:46330814-46330836 GCTGGCAGACAGATGGTGGATGG + Intronic
1166972353 19:46577726-46577748 GTTTGCAGTCAGATAGTGGCTGG + Intronic
1167565345 19:50252614-50252636 GAATGAAGTCAGGTAGAGGAGGG - Intronic
924984386 2:255759-255781 GTATTAAGTCAGATAGAGGAAGG + Intronic
926859664 2:17295549-17295571 GGTTGTAGCCAGATAGTGGCTGG - Intergenic
927301629 2:21522408-21522430 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
928476865 2:31635959-31635981 GTTTGAAGTCAAGTAGTGTAAGG + Intergenic
929684213 2:44020465-44020487 GCTTGCTGAGAGATAGTGGAGGG + Intergenic
933421134 2:82046398-82046420 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
935073580 2:99718086-99718108 TCTTGAAGTCAGGTACTGTAAGG + Intronic
935341627 2:102064261-102064283 GCCTGAAGTCTGATGGAGGAGGG + Intergenic
936118982 2:109725328-109725350 TCTTGATGCCAGAAAGTGGAGGG + Intergenic
936744274 2:115555597-115555619 ACTTGTAGTCAGAAAGTGGGAGG + Intronic
937237497 2:120439572-120439594 GCTTGAATGCAGATAGGAGAAGG - Intergenic
937657093 2:124388646-124388668 GCTTGAAGTCAGACCAGGGATGG - Intronic
937799882 2:126071069-126071091 ACTTGAAGTCTGATATTTGAGGG - Intergenic
939766429 2:146255859-146255881 GCTAGAAGTGAGTGAGTGGAGGG - Intergenic
939826753 2:147024533-147024555 GCTGGAAGTCAGAAATTGAAGGG + Intergenic
940139175 2:150474494-150474516 ACCTCAAGTCAGATAGTGAAAGG - Intronic
940183245 2:150957130-150957152 GCTTGCTGAGAGATAGTGGAGGG - Intergenic
941218413 2:162742837-162742859 GCTCCAATTCAGGTAGTGGAAGG + Intronic
941280499 2:163544124-163544146 GCTTGAAATCAGGTAGTATAAGG + Intergenic
941679623 2:168383301-168383323 TCTTGAAGTCAGGTAGTGTAAGG - Intergenic
942131390 2:172883797-172883819 GCTTGAAGTCAGATTTGGGTTGG - Intronic
942388602 2:175467906-175467928 GGTTGAGGCCAGATGGTGGAAGG + Intergenic
942677236 2:178440677-178440699 GCTTGAACTAAGGTAGTGGCTGG - Intronic
943208258 2:184928401-184928423 GCTTGAAGAGAGATAGGGGAGGG - Intronic
944237679 2:197455095-197455117 GCTTGTAATCAGATTGTGTAAGG + Intronic
946064003 2:216970548-216970570 TCTTGCAGTCAGATATTGGCTGG + Intergenic
1169434120 20:5569723-5569745 GTTTGGAGTTAGATGGTGGAGGG - Intronic
1169788139 20:9382486-9382508 GCTTGAAGTGAGATTGGAGATGG - Intronic
1170009831 20:11710679-11710701 TTTTGAAGTCAGAAAGTGTAAGG - Intergenic
1171327804 20:24311146-24311168 GCTGGAAGTCAGAGAGTGCTGGG + Intergenic
1172266519 20:33619870-33619892 GCTGGAAGTGTGAAAGTGGAAGG + Intronic
1172863539 20:38076998-38077020 GCTTGAAGTCAGGAGGTGGGAGG - Intronic
1174499055 20:50970848-50970870 GCTGGAAGGGAGATTGTGGAAGG - Intergenic
1178125264 21:29509022-29509044 GCTATCATTCAGATAGTGGAAGG - Intronic
1180819089 22:18813055-18813077 GGTTGCAGTCAGATAGTGGCTGG - Intergenic
1181205313 22:21247503-21247525 GGTTGCAGTCAGATAGTGGCTGG - Intergenic
1182069005 22:27450276-27450298 GGTTGAAGTCAGAGAAGGGAAGG - Intergenic
1182079337 22:27518120-27518142 GCTTGTAGTCAGACAGTAGGTGG - Intergenic
1182097475 22:27635869-27635891 GCTGGAAGTCAGGTAGTGAGGGG - Intergenic
1182907602 22:33951417-33951439 GCTTGGAGTCTGATGTTGGAGGG + Intergenic
1183568590 22:38634796-38634818 GCCTGCAGTCAGTCAGTGGAAGG - Intronic
1184522747 22:45005246-45005268 GCTGTGATTCAGATAGTGGAGGG - Intronic
1184947227 22:47812151-47812173 CCTTGAAGACAGAGATTGGAGGG + Intergenic
1203221612 22_KI270731v1_random:47912-47934 GGTTGCAGTCAGATAGTGGCTGG + Intergenic
1203269214 22_KI270734v1_random:38908-38930 GGTTGCAGTCAGATAGTGGCTGG - Intergenic
1202729968 2_KI270716v1_random:55773-55795 GCTTCAAGACTGTTAGTGGAGGG - Intergenic
949870833 3:8586944-8586966 ACTTGAAGTCCGATGTTGGAGGG + Intergenic
951482999 3:23181649-23181671 GCTTGATGTGAGTTAGTGAAGGG + Intergenic
953139008 3:40210312-40210334 TCTTGATGAAAGATAGTGGAAGG - Intronic
954844278 3:53541757-53541779 GCTTGAAGACAAACAGTGGATGG - Intronic
954907158 3:54072669-54072691 GCTGGAAGTCATCTGGTGGAAGG - Intergenic
956155672 3:66293932-66293954 GCTTGAAGTCTGGTAGTGTGAGG + Intronic
962134335 3:132718307-132718329 GCTTGAAATCACAGAGTGAAAGG - Intronic
964212661 3:154245690-154245712 GTTTGGAGTCATACAGTGGAGGG - Intronic
964638023 3:158878661-158878683 ACTTGCAGTCAGATTGTGGTTGG + Intergenic
965380981 3:167987756-167987778 TCTTGAAGATAGAGAGTGGAGGG + Intergenic
966202220 3:177369070-177369092 GCTTGAACTCAGGAGGTGGAGGG - Intergenic
967328336 3:188265039-188265061 GCTTTGAGTCAGAAAGTGGGTGG - Intronic
969250537 4:5965390-5965412 GCTTGCAGCCAGGTAGGGGAAGG - Intronic
970588232 4:17534749-17534771 GCTGGAAGTCATAGAGGGGAAGG + Intergenic
971709687 4:30094403-30094425 GCAAGAAGGCAGAAAGTGGAGGG + Intergenic
972223507 4:36984255-36984277 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
974895919 4:67938824-67938846 GTTTGAAGTCAGATAATGTGAGG + Intronic
974904106 4:68035065-68035087 GCTTGCTGACAGGTAGTGGAGGG - Intergenic
975590044 4:75990707-75990729 GCTAGAGGCCGGATAGTGGATGG - Intronic
977111726 4:92964806-92964828 GCTTAAAGAAAGATAGTGGCTGG + Intronic
978010004 4:103668764-103668786 GCTTGAACTCGGGAAGTGGAGGG + Intronic
978949409 4:114539057-114539079 GGTTGAACCCAGATTGTGGAGGG + Intergenic
981829948 4:148987937-148987959 GTTTAAAGTCAGAAAGTAGAAGG - Intergenic
982115289 4:152093916-152093938 GCTTGAGGGCAGAGAGGGGACGG + Intergenic
983056349 4:163102502-163102524 GCTTGCTGAGAGATAGTGGAGGG + Intergenic
984892496 4:184506190-184506212 GCTTGAACTCAGGAGGTGGAGGG - Intergenic
986840043 5:11686121-11686143 GCTTGAGCTCAGGAAGTGGAGGG + Intronic
987345214 5:16972831-16972853 GCTTGAAGCCACATGGAGGATGG - Intergenic
989739642 5:44755616-44755638 GCTTGTGGTCAGATGGTGGCTGG - Intergenic
991150672 5:63364710-63364732 GCTTGAACTCAGGAGGTGGAGGG + Intergenic
991306183 5:65178350-65178372 GCTTGAAATCAAATAGAGGCAGG + Intronic
992641172 5:78769439-78769461 GCTTGAATTCAGGAGGTGGAGGG + Intronic
993036418 5:82762443-82762465 ACTTGAAGTCTGATATTTGAGGG - Intergenic
994703835 5:103174459-103174481 GGTTGTAGTCAGACAGTGGCTGG + Intronic
994917266 5:105996065-105996087 ACTTGAAGTCCGATGTTGGAGGG - Intergenic
995721002 5:115132773-115132795 GTTTTCAGTCACATAGTGGAGGG - Intronic
995810527 5:116102471-116102493 ATTTGAAGTCAGAGAGTGTAAGG + Intronic
998642229 5:144023903-144023925 GCTTGAACCCAGAGAATGGATGG - Intergenic
998647790 5:144082672-144082694 GCTTGAAGTTGGAGAGTGGGAGG + Intergenic
999351703 5:150877422-150877444 ACTTGAAGTCTGATATTCGATGG - Intronic
999664825 5:153901749-153901771 GGTTGCAGTCAGATGGTGGCTGG - Intergenic
999734940 5:154506064-154506086 GCTGGAAGGAAGCTAGTGGAAGG - Intergenic
1000205327 5:159052632-159052654 GCTGGAATTCAGAGACTGGACGG + Intronic
1001063235 5:168512639-168512661 ACTTGGAGTCAGATATTCGAGGG + Intronic
1001590977 5:172865135-172865157 GCTTGAACCCAGAAAGTAGAGGG - Intronic
1001754422 5:174157373-174157395 GCTGGGAGCCAGATTGTGGAGGG - Intronic
1002537251 5:179883255-179883277 GCTTGAACTTGTATAGTGGAAGG - Intronic
1002999907 6:2321492-2321514 TTTTGAAGTCAGAAAGTGTAAGG + Intergenic
1003514699 6:6808172-6808194 GCTTGAAGTTGCATAGGGGATGG - Intergenic
1005412292 6:25562775-25562797 GTTTGAAGTCATTTTGTGGAGGG - Intronic
1006288237 6:33114189-33114211 GCTTAAAGTGAGAGAGGGGAGGG + Intergenic
1008035528 6:46741461-46741483 GCTTGAGGCCAGATCCTGGAAGG - Intergenic
1009597311 6:65752312-65752334 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1009772217 6:68158224-68158246 GCTTGAACTCAGGAGGTGGAGGG + Intergenic
1010004295 6:70978871-70978893 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1011362545 6:86543372-86543394 ACTTGAAGGTAGACAGTGGAAGG + Intergenic
1012422713 6:99081920-99081942 GGTTGCAGTCAGATATTGGCTGG + Intergenic
1014115341 6:117663142-117663164 ACTTGAAGTAAGATCCTGGAGGG + Intergenic
1014990020 6:128063100-128063122 ATTTGAACTCAGATAGTGTAAGG + Intronic
1017183875 6:151580653-151580675 GCTTGAAATTAGATATTTGATGG - Intronic
1017917828 6:158846289-158846311 GCTTTAAGCCAGAGAGGGGATGG + Intergenic
1017922545 6:158884823-158884845 GCTTGCTGAGAGATAGTGGAGGG + Intronic
1018442870 6:163829081-163829103 GCTTGCAGCCAGACTGTGGAGGG + Intergenic
1018638189 6:165883457-165883479 GCTTGAACCCAGATGGTGGGAGG + Intronic
1021317932 7:19173263-19173285 GATTACAGTCAGATAGTGGCTGG - Intergenic
1022119757 7:27296724-27296746 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1022278149 7:28876550-28876572 GCTTGAAGCCAGGGGGTGGACGG + Intergenic
1023413130 7:39907847-39907869 TTTTGAAGTGAGATAGTGGGAGG - Intergenic
1024269831 7:47633971-47633993 GTTTAAAGTCAGAGAGAGGAGGG + Intergenic
1024405215 7:48971347-48971369 ACTTAAAGGCAAATAGTGGAAGG + Intergenic
1024550956 7:50562080-50562102 GCTTAAAGTCAGAGGATGGATGG - Intronic
1027610385 7:80352578-80352600 ACTTGAAGTCTGATATTTGAGGG + Intergenic
1027700258 7:81460922-81460944 GCTTGAAGTTAGATCATGTAAGG + Intergenic
1027780997 7:82520318-82520340 TCTGGAAGACAGAAAGTGGATGG + Intergenic
1027847494 7:83400537-83400559 GCTTGAAGTCAGAGGGTGGGAGG - Intronic
1028039764 7:86036923-86036945 GCTTGAAGAAAGAATGTGGAAGG - Intergenic
1029317500 7:99727722-99727744 GCTTGCTGAGAGATAGTGGAGGG - Intronic
1029503526 7:100948811-100948833 GCTTGAAACCAGAAGGTGGAGGG - Intergenic
1029883003 7:103836619-103836641 GCTTGCAGGAAGATAGAGGAGGG - Intronic
1030776311 7:113537933-113537955 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1031236402 7:119184419-119184441 ACTTGAAGTCCGATGGTCGAGGG - Intergenic
1032136933 7:129288441-129288463 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1032826632 7:135576104-135576126 GCAAGAAGTTAGACAGTGGATGG + Intronic
1033422550 7:141216777-141216799 ACTTCAAGCCAGATAGTGGGTGG - Intronic
1033486056 7:141790232-141790254 GCTTGAAGACAGATTACGGAAGG + Exonic
1034747450 7:153535720-153535742 GCTTGGAGTCCGATGTTGGAGGG - Intergenic
1035917255 8:3638164-3638186 GTTTGAAGTAAAATATTGGAAGG - Intronic
1037525220 8:19717977-19717999 GCTTGATGGCGGATGGTGGATGG - Intronic
1037897064 8:22664785-22664807 GCATGAAGTCAGACAAAGGACGG + Intronic
1038345814 8:26731515-26731537 GACTGAGGTCAGATTGTGGAGGG + Intergenic
1039192988 8:34998260-34998282 TGTAGAATTCAGATAGTGGAAGG - Intergenic
1039323862 8:36463935-36463957 ACTTGAAGTCCGATATTTGAGGG + Intergenic
1041637970 8:60165079-60165101 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1041914896 8:63128822-63128844 GCTTGAAGCCAGGAGGTGGAGGG - Intergenic
1043320970 8:78986221-78986243 TTTTGAAGTCAGGTAGTGAAAGG - Intergenic
1043381801 8:79710366-79710388 GCTTGAACTCAGAAGGTGGAGGG - Intergenic
1043393408 8:79812880-79812902 GCTTGAGGACAAATACTGGAGGG + Intergenic
1044191601 8:89325641-89325663 GCTTAAAGTCAAGTTGTGGATGG - Intergenic
1044201631 8:89445197-89445219 GTTTGAAGTCAGGTAGTGGGAGG + Intergenic
1045678872 8:104637440-104637462 ACTTGAAGTCTGATATTCGAGGG + Intronic
1048155239 8:131941588-131941610 GCTTTATGTCAGTTACTGGATGG - Intronic
1048255318 8:132901130-132901152 GCTTGAGGGCAGGCAGTGGAGGG + Intronic
1048521522 8:135159851-135159873 ACTTGAAGTCTGATATTTGAGGG - Intergenic
1048873215 8:138815799-138815821 GCTTGAGCTCAGTCAGTGGAGGG + Intronic
1049166813 8:141131097-141131119 GCTTCATGTTGGATAGTGGAGGG + Intronic
1049857019 8:144868664-144868686 ACTTGGAGTCAGATGTTGGAGGG - Intergenic
1050914706 9:11117526-11117548 CCTTGAGGTCAGATAATGTAAGG + Intergenic
1051247279 9:15124506-15124528 TCCTGAAGTCAGGTAGTGTAAGG - Intergenic
1051283476 9:15468035-15468057 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1052788187 9:32849527-32849549 GGTTGACCTCAGAAAGTGGAAGG + Intergenic
1054708582 9:68487847-68487869 GCTTGAAGTCAGAAAGTTTTGGG + Intronic
1055962147 9:81830707-81830729 GCTTGAACTCAGGAGGTGGAGGG + Intergenic
1056366239 9:85908304-85908326 GCTTTTAGTCAGATAAGGGAAGG - Intergenic
1057164105 9:92913047-92913069 GCTTGGGGTCAGAAAGTGGGTGG - Intergenic
1058642677 9:107102576-107102598 GGGTGAAGTCAGCTACTGGAAGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059381610 9:113931403-113931425 GCTCAAAGTCAGGGAGTGGAGGG + Intronic
1059397042 9:114041744-114041766 GTTTGAAGTCAGGTAGTGTGAGG + Intronic
1059420495 9:114187555-114187577 CCTTGAGGTCAGACAGTTGAGGG - Intronic
1059968771 9:119642874-119642896 GTTTGAAGTCAGGTAGTGTGTGG + Intergenic
1061407269 9:130399398-130399420 GCTGGAGGTCAGATACAGGAAGG + Intronic
1062209876 9:135357678-135357700 GCTTGAACCCAGGAAGTGGAGGG - Intergenic
1189184598 X:39042601-39042623 GGTTGCAATCAGATAGTGGTTGG + Intergenic
1189815121 X:44817078-44817100 GGTTGCAGTCAGATGGTGGCAGG + Intergenic
1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG + Intergenic
1191005514 X:55707155-55707177 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1192029868 X:67498423-67498445 TCTTGAAGACAGAGAGTAGAAGG + Intergenic
1192370977 X:70512643-70512665 GCTTATAGTCTGATAGGGGAAGG - Intergenic
1192388517 X:70699270-70699292 GGTTGCAGTCAGATAGTGGCTGG - Intronic
1193465777 X:81845745-81845767 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1193577912 X:83226535-83226557 GCTTGAAGTCAGGTACTGTGAGG + Intergenic
1194814495 X:98425743-98425765 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1195442258 X:104911727-104911749 GCTGTATGTCAGATAGTGCAGGG - Intronic
1196714013 X:118793868-118793890 TCTTGAAGTCAGATTGAGGCTGG + Exonic
1197856077 X:130915353-130915375 GCTTCAACCCAGAGAGTGGATGG - Intergenic
1199200209 X:145078450-145078472 GCTCAAAGTCAGACAGTGAATGG - Intergenic
1199299830 X:146199992-146200014 GCTTGCAGTCAGACTCTGGAAGG - Intergenic
1202303872 Y:23447196-23447218 GCTTGAAGTCTGAAACTGGATGG - Intergenic
1202566938 Y:26223395-26223417 GCTTGAAGTCTGAAACTGGATGG + Intergenic