ID: 908043410

View in Genome Browser
Species Human (GRCh38)
Location 1:60141488-60141510
Sequence ATGGAAAAGCAGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908043406_908043410 12 Left 908043406 1:60141453-60141475 CCGTGAGAATGGAAACCACATGA No data
Right 908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG No data
908043407_908043410 -3 Left 908043407 1:60141468-60141490 CCACATGATTGTGACAGTAAATG No data
Right 908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG No data
908043405_908043410 16 Left 908043405 1:60141449-60141471 CCATCCGTGAGAATGGAAACCAC No data
Right 908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908043410 Original CRISPR ATGGAAAAGCAGAAGGAAGC TGG Intergenic
No off target data available for this crispr