ID: 908055087

View in Genome Browser
Species Human (GRCh38)
Location 1:60277411-60277433
Sequence CAGTGTACTCATGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908055077_908055087 9 Left 908055077 1:60277379-60277401 CCTTCTCACTGTGTCCTCATGTG 0: 23
1: 129
2: 528
3: 1175
4: 2419
Right 908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG No data
908055076_908055087 12 Left 908055076 1:60277376-60277398 CCACCTTCTCACTGTGTCCTCAT 0: 12
1: 170
2: 440
3: 1026
4: 1865
Right 908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG No data
908055079_908055087 -5 Left 908055079 1:60277393-60277415 CCTCATGTGGCCTTTCCTCAGTG No data
Right 908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG No data
908055075_908055087 28 Left 908055075 1:60277360-60277382 CCTGGCTTAAAGATGGCCACCTT No data
Right 908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908055087 Original CRISPR CAGTGTACTCATGAGGGGGA GGG Intergenic
No off target data available for this crispr