ID: 908056936

View in Genome Browser
Species Human (GRCh38)
Location 1:60297918-60297940
Sequence GTTTTTAAGAGTACTGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908056936_908056939 30 Left 908056936 1:60297918-60297940 CCGACCACAGTACTCTTAAAAAC No data
Right 908056939 1:60297971-60297993 TAAGATTCAAATCCAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908056936 Original CRISPR GTTTTTAAGAGTACTGTGGT CGG (reversed) Intergenic
No off target data available for this crispr