ID: 908061320

View in Genome Browser
Species Human (GRCh38)
Location 1:60352772-60352794
Sequence CCTTATATGAAGAGGAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908061317_908061320 -7 Left 908061317 1:60352756-60352778 CCAATCTGTCTGGCATCCTTATA No data
Right 908061320 1:60352772-60352794 CCTTATATGAAGAGGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908061320 Original CRISPR CCTTATATGAAGAGGAAATT TGG Intergenic
No off target data available for this crispr