ID: 908067270

View in Genome Browser
Species Human (GRCh38)
Location 1:60420461-60420483
Sequence GTGTCTCAGCAGCAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908067267_908067270 7 Left 908067267 1:60420431-60420453 CCAGCTGCTGATGGAAGCGACTT No data
Right 908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908067270 Original CRISPR GTGTCTCAGCAGCAGGAAGG TGG Intergenic
No off target data available for this crispr