ID: 908068006

View in Genome Browser
Species Human (GRCh38)
Location 1:60428333-60428355
Sequence CCTTCAGCACATAAGCATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908068004_908068006 29 Left 908068004 1:60428281-60428303 CCGAAACTAGCTATGCAGACTTC No data
Right 908068006 1:60428333-60428355 CCTTCAGCACATAAGCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908068006 Original CRISPR CCTTCAGCACATAAGCATCT CGG Intergenic
No off target data available for this crispr