ID: 908068395

View in Genome Browser
Species Human (GRCh38)
Location 1:60432721-60432743
Sequence CTCTAAATACAGTTGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908068395_908068397 13 Left 908068395 1:60432721-60432743 CCAAACTGCAACTGTATTTAGAG No data
Right 908068397 1:60432757-60432779 AGTTTTCATTCTGAGGCATGAGG No data
908068395_908068396 6 Left 908068395 1:60432721-60432743 CCAAACTGCAACTGTATTTAGAG No data
Right 908068396 1:60432750-60432772 CAGAGATAGTTTTCATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908068395 Original CRISPR CTCTAAATACAGTTGCAGTT TGG (reversed) Intergenic
No off target data available for this crispr