ID: 908071357

View in Genome Browser
Species Human (GRCh38)
Location 1:60463943-60463965
Sequence CTCTCTGGGGTTTGCCCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908071357_908071364 11 Left 908071357 1:60463943-60463965 CCTTCCGGGCAAACCCCAGAGAG No data
Right 908071364 1:60463977-60463999 CAAAGGCATTAAGGCAAGAGAGG No data
908071357_908071362 -6 Left 908071357 1:60463943-60463965 CCTTCCGGGCAAACCCCAGAGAG No data
Right 908071362 1:60463960-60463982 AGAGAGTTCAGTATATGCAAAGG No data
908071357_908071363 2 Left 908071357 1:60463943-60463965 CCTTCCGGGCAAACCCCAGAGAG No data
Right 908071363 1:60463968-60463990 CAGTATATGCAAAGGCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908071357 Original CRISPR CTCTCTGGGGTTTGCCCGGA AGG (reversed) Intergenic
No off target data available for this crispr