ID: 908071363

View in Genome Browser
Species Human (GRCh38)
Location 1:60463968-60463990
Sequence CAGTATATGCAAAGGCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908071357_908071363 2 Left 908071357 1:60463943-60463965 CCTTCCGGGCAAACCCCAGAGAG No data
Right 908071363 1:60463968-60463990 CAGTATATGCAAAGGCATTAAGG No data
908071358_908071363 -2 Left 908071358 1:60463947-60463969 CCGGGCAAACCCCAGAGAGTTCA No data
Right 908071363 1:60463968-60463990 CAGTATATGCAAAGGCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908071363 Original CRISPR CAGTATATGCAAAGGCATTA AGG Intergenic
No off target data available for this crispr