ID: 908072600

View in Genome Browser
Species Human (GRCh38)
Location 1:60479012-60479034
Sequence ACCGCACCCAACCATAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908072596_908072600 9 Left 908072596 1:60478980-60479002 CCGCCCAAAGTTCTGGATTACAA No data
Right 908072600 1:60479012-60479034 ACCGCACCCAACCATAGATAAGG No data
908072598_908072600 5 Left 908072598 1:60478984-60479006 CCAAAGTTCTGGATTACAAGCAT No data
Right 908072600 1:60479012-60479034 ACCGCACCCAACCATAGATAAGG No data
908072594_908072600 18 Left 908072594 1:60478971-60478993 CCACTTCAGCCGCCCAAAGTTCT No data
Right 908072600 1:60479012-60479034 ACCGCACCCAACCATAGATAAGG No data
908072597_908072600 6 Left 908072597 1:60478983-60479005 CCCAAAGTTCTGGATTACAAGCA No data
Right 908072600 1:60479012-60479034 ACCGCACCCAACCATAGATAAGG No data
908072593_908072600 19 Left 908072593 1:60478970-60478992 CCCACTTCAGCCGCCCAAAGTTC No data
Right 908072600 1:60479012-60479034 ACCGCACCCAACCATAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908072600 Original CRISPR ACCGCACCCAACCATAGATA AGG Intergenic
No off target data available for this crispr