ID: 908077346 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:60535161-60535183 |
Sequence | GGCCTACAGAGGAGTGATGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 262 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 246} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908077346_908077357 | 30 | Left | 908077346 | 1:60535161-60535183 | CCAACATCACTCCTCTGTAGGCC | 0: 1 1: 0 2: 0 3: 15 4: 246 |
||
Right | 908077357 | 1:60535214-60535236 | GCTGGGCTCCTTAGTAACCCGGG | No data | ||||
908077346_908077356 | 29 | Left | 908077346 | 1:60535161-60535183 | CCAACATCACTCCTCTGTAGGCC | 0: 1 1: 0 2: 0 3: 15 4: 246 |
||
Right | 908077356 | 1:60535213-60535235 | AGCTGGGCTCCTTAGTAACCCGG | No data | ||||
908077346_908077355 | 13 | Left | 908077346 | 1:60535161-60535183 | CCAACATCACTCCTCTGTAGGCC | 0: 1 1: 0 2: 0 3: 15 4: 246 |
||
Right | 908077355 | 1:60535197-60535219 | AGAAAAGAAATCTCAAAGCTGGG | No data | ||||
908077346_908077354 | 12 | Left | 908077346 | 1:60535161-60535183 | CCAACATCACTCCTCTGTAGGCC | 0: 1 1: 0 2: 0 3: 15 4: 246 |
||
Right | 908077354 | 1:60535196-60535218 | TAGAAAAGAAATCTCAAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908077346 | Original CRISPR | GGCCTACAGAGGAGTGATGT TGG (reversed) | Intergenic | ||