ID: 908077346

View in Genome Browser
Species Human (GRCh38)
Location 1:60535161-60535183
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077346_908077357 30 Left 908077346 1:60535161-60535183 CCAACATCACTCCTCTGTAGGCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data
908077346_908077356 29 Left 908077346 1:60535161-60535183 CCAACATCACTCCTCTGTAGGCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data
908077346_908077355 13 Left 908077346 1:60535161-60535183 CCAACATCACTCCTCTGTAGGCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 908077355 1:60535197-60535219 AGAAAAGAAATCTCAAAGCTGGG No data
908077346_908077354 12 Left 908077346 1:60535161-60535183 CCAACATCACTCCTCTGTAGGCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 908077354 1:60535196-60535218 TAGAAAAGAAATCTCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908077346 Original CRISPR GGCCTACAGAGGAGTGATGT TGG (reversed) Intergenic