ID: 908077350

View in Genome Browser
Species Human (GRCh38)
Location 1:60535172-60535194
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077350_908077360 28 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077360 1:60535223-60535245 CTTAGTAACCCGGGGCATGATGG No data
908077350_908077357 19 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data
908077350_908077358 20 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077358 1:60535215-60535237 CTGGGCTCCTTAGTAACCCGGGG No data
908077350_908077355 2 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077355 1:60535197-60535219 AGAAAAGAAATCTCAAAGCTGGG No data
908077350_908077356 18 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data
908077350_908077354 1 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077354 1:60535196-60535218 TAGAAAAGAAATCTCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908077350 Original CRISPR CGGTCAGCCCCGGCCTACAG AGG (reversed) Intergenic