ID: 908077352

View in Genome Browser
Species Human (GRCh38)
Location 1:60535182-60535204
Sequence TCTTTTCTACCGGTCAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077352_908077355 -8 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077355 1:60535197-60535219 AGAAAAGAAATCTCAAAGCTGGG No data
908077352_908077358 10 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077358 1:60535215-60535237 CTGGGCTCCTTAGTAACCCGGGG No data
908077352_908077357 9 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data
908077352_908077360 18 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077360 1:60535223-60535245 CTTAGTAACCCGGGGCATGATGG No data
908077352_908077354 -9 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077354 1:60535196-60535218 TAGAAAAGAAATCTCAAAGCTGG No data
908077352_908077356 8 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908077352 Original CRISPR TCTTTTCTACCGGTCAGCCC CGG (reversed) Intergenic