ID: 908077353

View in Genome Browser
Species Human (GRCh38)
Location 1:60535192-60535214
Sequence CTTTGAGATTTCTTTTCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077353_908077360 8 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077360 1:60535223-60535245 CTTAGTAACCCGGGGCATGATGG No data
908077353_908077358 0 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077358 1:60535215-60535237 CTGGGCTCCTTAGTAACCCGGGG No data
908077353_908077357 -1 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data
908077353_908077363 26 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077363 1:60535241-60535263 GATGGAGTCCCTATGACTTGTGG No data
908077353_908077356 -2 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908077353 Original CRISPR CTTTGAGATTTCTTTTCTAC CGG (reversed) Intergenic