ID: 908077355

View in Genome Browser
Species Human (GRCh38)
Location 1:60535197-60535219
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077346_908077355 13 Left 908077346 1:60535161-60535183 CCAACATCACTCCTCTGTAGGCC No data
Right 908077355 1:60535197-60535219 AGAAAAGAAATCTCAAAGCTGGG No data
908077352_908077355 -8 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077355 1:60535197-60535219 AGAAAAGAAATCTCAAAGCTGGG No data
908077350_908077355 2 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077355 1:60535197-60535219 AGAAAAGAAATCTCAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type