ID: 908077355 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:60535197-60535219 |
Sequence | AGAAAAGAAATCTCAAAGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908077346_908077355 | 13 | Left | 908077346 | 1:60535161-60535183 | CCAACATCACTCCTCTGTAGGCC | No data | ||
Right | 908077355 | 1:60535197-60535219 | AGAAAAGAAATCTCAAAGCTGGG | No data | ||||
908077352_908077355 | -8 | Left | 908077352 | 1:60535182-60535204 | CCGGGGCTGACCGGTAGAAAAGA | No data | ||
Right | 908077355 | 1:60535197-60535219 | AGAAAAGAAATCTCAAAGCTGGG | No data | ||||
908077350_908077355 | 2 | Left | 908077350 | 1:60535172-60535194 | CCTCTGTAGGCCGGGGCTGACCG | No data | ||
Right | 908077355 | 1:60535197-60535219 | AGAAAAGAAATCTCAAAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908077355 | Original CRISPR | AGAAAAGAAATCTCAAAGCT GGG | Intergenic | ||