ID: 908077356

View in Genome Browser
Species Human (GRCh38)
Location 1:60535213-60535235
Sequence AGCTGGGCTCCTTAGTAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077350_908077356 18 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data
908077346_908077356 29 Left 908077346 1:60535161-60535183 CCAACATCACTCCTCTGTAGGCC No data
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data
908077352_908077356 8 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data
908077353_908077356 -2 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077356 1:60535213-60535235 AGCTGGGCTCCTTAGTAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908077356 Original CRISPR AGCTGGGCTCCTTAGTAACC CGG Intergenic