ID: 908077357

View in Genome Browser
Species Human (GRCh38)
Location 1:60535214-60535236
Sequence GCTGGGCTCCTTAGTAACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077353_908077357 -1 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data
908077350_908077357 19 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data
908077352_908077357 9 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data
908077346_908077357 30 Left 908077346 1:60535161-60535183 CCAACATCACTCCTCTGTAGGCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 908077357 1:60535214-60535236 GCTGGGCTCCTTAGTAACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908077357 Original CRISPR GCTGGGCTCCTTAGTAACCC GGG Intergenic