ID: 908077358

View in Genome Browser
Species Human (GRCh38)
Location 1:60535215-60535237
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077353_908077358 0 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077358 1:60535215-60535237 CTGGGCTCCTTAGTAACCCGGGG No data
908077350_908077358 20 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077358 1:60535215-60535237 CTGGGCTCCTTAGTAACCCGGGG No data
908077352_908077358 10 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077358 1:60535215-60535237 CTGGGCTCCTTAGTAACCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type