ID: 908077360

View in Genome Browser
Species Human (GRCh38)
Location 1:60535223-60535245
Sequence CTTAGTAACCCGGGGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908077353_908077360 8 Left 908077353 1:60535192-60535214 CCGGTAGAAAAGAAATCTCAAAG No data
Right 908077360 1:60535223-60535245 CTTAGTAACCCGGGGCATGATGG No data
908077350_908077360 28 Left 908077350 1:60535172-60535194 CCTCTGTAGGCCGGGGCTGACCG No data
Right 908077360 1:60535223-60535245 CTTAGTAACCCGGGGCATGATGG No data
908077352_908077360 18 Left 908077352 1:60535182-60535204 CCGGGGCTGACCGGTAGAAAAGA No data
Right 908077360 1:60535223-60535245 CTTAGTAACCCGGGGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908077360 Original CRISPR CTTAGTAACCCGGGGCATGA TGG Intergenic