ID: 908080385

View in Genome Browser
Species Human (GRCh38)
Location 1:60571259-60571281
Sequence GAAAAAAGACACATGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908080382_908080385 12 Left 908080382 1:60571224-60571246 CCCAGTAAGTGAATGAGCTTAGT No data
Right 908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG No data
908080381_908080385 13 Left 908080381 1:60571223-60571245 CCCCAGTAAGTGAATGAGCTTAG No data
Right 908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG No data
908080383_908080385 11 Left 908080383 1:60571225-60571247 CCAGTAAGTGAATGAGCTTAGTT No data
Right 908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908080385 Original CRISPR GAAAAAAGACACATGCAGCT AGG Intergenic
No off target data available for this crispr