ID: 908081399

View in Genome Browser
Species Human (GRCh38)
Location 1:60582685-60582707
Sequence TCAGTTACACACTTAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908081396_908081399 20 Left 908081396 1:60582642-60582664 CCAACTAAGCTAGGAGAGGGTTC No data
Right 908081399 1:60582685-60582707 TCAGTTACACACTTAAAGATGGG No data
908081395_908081399 21 Left 908081395 1:60582641-60582663 CCCAACTAAGCTAGGAGAGGGTT No data
Right 908081399 1:60582685-60582707 TCAGTTACACACTTAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908081399 Original CRISPR TCAGTTACACACTTAAAGAT GGG Intergenic
No off target data available for this crispr