ID: 908085723

View in Genome Browser
Species Human (GRCh38)
Location 1:60631695-60631717
Sequence CCAGTCCAGTGTGAGATCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908085719_908085723 -1 Left 908085719 1:60631673-60631695 CCAAACATCATTCAAACATCTCC No data
Right 908085723 1:60631695-60631717 CCAGTCCAGTGTGAGATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908085723 Original CRISPR CCAGTCCAGTGTGAGATCTT GGG Intergenic
No off target data available for this crispr