ID: 908086333

View in Genome Browser
Species Human (GRCh38)
Location 1:60638509-60638531
Sequence TAGTGCCAAAGTTATTTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908086330_908086333 20 Left 908086330 1:60638466-60638488 CCATTACTATAATAAAAAAATTG No data
Right 908086333 1:60638509-60638531 TAGTGCCAAAGTTATTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908086333 Original CRISPR TAGTGCCAAAGTTATTTAGT GGG Intergenic
No off target data available for this crispr