ID: 908087758

View in Genome Browser
Species Human (GRCh38)
Location 1:60654395-60654417
Sequence CTGGATCTACTGCTGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908087758_908087761 21 Left 908087758 1:60654395-60654417 CCTAGCTTCAGCAGTAGATCCAG No data
Right 908087761 1:60654439-60654461 AGTCTAATCAGAGAATGTCTTGG No data
908087758_908087762 22 Left 908087758 1:60654395-60654417 CCTAGCTTCAGCAGTAGATCCAG No data
Right 908087762 1:60654440-60654462 GTCTAATCAGAGAATGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908087758 Original CRISPR CTGGATCTACTGCTGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr