ID: 908092299

View in Genome Browser
Species Human (GRCh38)
Location 1:60698982-60699004
Sequence CTTGATTTGCAAAAGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908092296_908092299 5 Left 908092296 1:60698954-60698976 CCTAACCTGGCATAGCAAAATCA No data
Right 908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG No data
908092297_908092299 0 Left 908092297 1:60698959-60698981 CCTGGCATAGCAAAATCAAGAGA No data
Right 908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908092299 Original CRISPR CTTGATTTGCAAAAGGAACC AGG Intergenic
No off target data available for this crispr