ID: 908096309

View in Genome Browser
Species Human (GRCh38)
Location 1:60742666-60742688
Sequence TGAGCACAGGTTACACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908096309_908096317 24 Left 908096309 1:60742666-60742688 CCTCCTGGTGTAACCTGTGCTCA No data
Right 908096317 1:60742713-60742735 AGACCTCAGACGGCATTCCAAGG No data
908096309_908096313 14 Left 908096309 1:60742666-60742688 CCTCCTGGTGTAACCTGTGCTCA No data
Right 908096313 1:60742703-60742725 TATCCCCTTCAGACCTCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908096309 Original CRISPR TGAGCACAGGTTACACCAGG AGG (reversed) Intergenic
No off target data available for this crispr