ID: 908098200

View in Genome Browser
Species Human (GRCh38)
Location 1:60762814-60762836
Sequence GGCTGTGTGTGGTGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908098191_908098200 24 Left 908098191 1:60762767-60762789 CCCAATATGCAAAACAGTTCAAA No data
Right 908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG No data
908098194_908098200 -4 Left 908098194 1:60762795-60762817 CCTGCTCCAAATCACAGCAGGCT No data
Right 908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG No data
908098195_908098200 -10 Left 908098195 1:60762801-60762823 CCAAATCACAGCAGGCTGTGTGT No data
Right 908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG No data
908098192_908098200 23 Left 908098192 1:60762768-60762790 CCAATATGCAAAACAGTTCAAAA No data
Right 908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908098200 Original CRISPR GGCTGTGTGTGGTGGGAAGA GGG Intergenic
No off target data available for this crispr