ID: 908103623

View in Genome Browser
Species Human (GRCh38)
Location 1:60816840-60816862
Sequence CTCTAGTCCTTTAGGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908103616_908103623 9 Left 908103616 1:60816808-60816830 CCCTGTAATACCAGGCCTACCAA No data
Right 908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG No data
908103620_908103623 -10 Left 908103620 1:60816827-60816849 CCAACCAGATCAACTCTAGTCCT No data
Right 908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG No data
908103619_908103623 -6 Left 908103619 1:60816823-60816845 CCTACCAACCAGATCAACTCTAG No data
Right 908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG No data
908103618_908103623 -1 Left 908103618 1:60816818-60816840 CCAGGCCTACCAACCAGATCAAC No data
Right 908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG No data
908103614_908103623 29 Left 908103614 1:60816788-60816810 CCAACTTTGTGTGAGAAATTCCC No data
Right 908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG No data
908103617_908103623 8 Left 908103617 1:60816809-60816831 CCTGTAATACCAGGCCTACCAAC No data
Right 908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908103623 Original CRISPR CTCTAGTCCTTTAGGTAAGA TGG Intergenic
No off target data available for this crispr