ID: 908103627

View in Genome Browser
Species Human (GRCh38)
Location 1:60816861-60816883
Sequence GGGGCATTTAGACCATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908103618_908103627 20 Left 908103618 1:60816818-60816840 CCAGGCCTACCAACCAGATCAAC No data
Right 908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG No data
908103621_908103627 7 Left 908103621 1:60816831-60816853 CCAGATCAACTCTAGTCCTTTAG No data
Right 908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG No data
908103617_908103627 29 Left 908103617 1:60816809-60816831 CCTGTAATACCAGGCCTACCAAC No data
Right 908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG No data
908103619_908103627 15 Left 908103619 1:60816823-60816845 CCTACCAACCAGATCAACTCTAG No data
Right 908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG No data
908103620_908103627 11 Left 908103620 1:60816827-60816849 CCAACCAGATCAACTCTAGTCCT No data
Right 908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG No data
908103616_908103627 30 Left 908103616 1:60816808-60816830 CCCTGTAATACCAGGCCTACCAA No data
Right 908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG No data
908103626_908103627 -9 Left 908103626 1:60816847-60816869 CCTTTAGGTAAGATGGGGCATTT No data
Right 908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908103627 Original CRISPR GGGGCATTTAGACCATTTGA TGG Intergenic
No off target data available for this crispr