ID: 908110348

View in Genome Browser
Species Human (GRCh38)
Location 1:60890815-60890837
Sequence GCAAACTTTTGTGCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908110348 Original CRISPR GCAAACTTTTGTGCTGCAGC TGG (reversed) Intronic
901847231 1:11991207-11991229 GCAAACATTTGTGCACCTGCTGG + Intronic
904655695 1:32045103-32045125 GAAAGCTTTTGGGGTGCAGCAGG - Intronic
906692460 1:47801574-47801596 GCACACTCTCCTGCTGCAGCAGG + Exonic
908110348 1:60890815-60890837 GCAAACTTTTGTGCTGCAGCTGG - Intronic
911063185 1:93764929-93764951 GCAAACATGTGTGCTACAGTGGG - Intronic
911155444 1:94632046-94632068 GAAAACTCTTGTGCTTCAACAGG - Intergenic
915049259 1:153050063-153050085 GCATACTTTTAGGCTGGAGCAGG - Intergenic
916026892 1:160840964-160840986 GCAAGCTTTTCTTCTGCAGAGGG - Intronic
918654638 1:187009378-187009400 GCATACTATTATGCTTCAGCAGG + Intergenic
919180380 1:194072969-194072991 TCAAACTGTTGTGCTGTAGTAGG - Intergenic
922792008 1:228316025-228316047 GCAAGTTTTTGAGCAGCAGCAGG - Exonic
1067273132 10:44809931-44809953 GGGGACTTTTGAGCTGCAGCTGG - Intergenic
1069180304 10:65350818-65350840 GCAAAGTTTATTGCTGCTGCAGG - Intergenic
1070862692 10:79685220-79685242 GAAAATTGTTGTACTGCAGCTGG - Intergenic
1072440872 10:95453826-95453848 GCAGACTTATGTCCTGCAGCGGG - Intronic
1077986355 11:7355223-7355245 GCACACCTGTGTCCTGCAGCTGG - Intronic
1082160017 11:48880385-48880407 GCAGACTTTGGTGCGGCAGGGGG + Intergenic
1084945120 11:72634215-72634237 GCACACTTCTGGCCTGCAGCTGG + Intronic
1088250556 11:107858167-107858189 GTTAAGTTTTGTGCTGCTGCCGG - Intronic
1091850403 12:3692670-3692692 GCACACTTATTGGCTGCAGCAGG + Intronic
1093255096 12:16857065-16857087 CAAAACTTTTCTGCTTCAGCCGG + Intergenic
1097356692 12:58610263-58610285 GCAGAATTGTGTGCTGCAGGTGG + Intronic
1099606165 12:84804224-84804246 GCATACATTTCTGCCGCAGCAGG - Intergenic
1103169381 12:118801188-118801210 GTAAACTTTTGTGCTTCAAAGGG - Intergenic
1105608994 13:21951123-21951145 GCCTGCTTTTGTGCGGCAGCTGG - Intergenic
1106464018 13:29996696-29996718 GCATACCTGGGTGCTGCAGCTGG + Intergenic
1112358363 13:98693690-98693712 GAAAACTTTTGTGCTGCAAATGG - Intronic
1114329194 14:21618912-21618934 GCAGACTTTGGTGCAGCAGTAGG - Intergenic
1114933583 14:27506415-27506437 GCAGACTCATTTGCTGCAGCAGG + Intergenic
1115645048 14:35363451-35363473 GCAAACTTGTATTCTCCAGCTGG + Intergenic
1117518514 14:56526954-56526976 TCAAACATTTGGGCTGCAACGGG + Intronic
1117638822 14:57775271-57775293 GCACACTTATCGGCTGCAGCAGG - Intronic
1119034407 14:71217541-71217563 TCAAACTTTTGTGCCAAAGCAGG + Intergenic
1128222402 15:65978636-65978658 TCCAACCTTTCTGCTGCAGCTGG + Intronic
1130445747 15:83999898-83999920 GAAAATATTTGTGGTGCAGCAGG + Intronic
1133565651 16:6991079-6991101 TCGAACTTCTGTGCTGAAGCAGG - Intronic
1135924227 16:26678196-26678218 GAAAACTTGTGTGCTCCATCAGG + Intergenic
1137553268 16:49454859-49454881 CCAAACTTTGGAGCTGCAGTGGG - Intergenic
1140682847 16:77402248-77402270 GTCATATTTTGTGCTGCAGCAGG - Intronic
1141305656 16:82861318-82861340 GTGAACTTTTGTGTTGCAGGGGG + Intronic
1144179354 17:12737341-12737363 GGAAACTTTTGTGATGCACTTGG - Intronic
1144676708 17:17166691-17166713 GCAGGCATTTGTGCTGCCGCAGG - Intronic
1147584756 17:41647856-41647878 GCATCCTTTTCTGCTGCTGCCGG - Intergenic
1151387742 17:73765339-73765361 GCTAACTATTGGGATGCAGCTGG - Intergenic
1157076617 18:44474052-44474074 GCAAAATTTTAGGCTGCAGCAGG + Intergenic
1162432536 19:10637640-10637662 GCAAACTTGTTCTCTGCAGCTGG - Exonic
927221240 2:20711903-20711925 GCAAGCCTTGGTGCTGCAGTGGG - Intronic
927342682 2:22000330-22000352 GCAGCCTTCTGTGCTGCAGAGGG + Intergenic
937048699 2:118870074-118870096 GCAAATGTTTGAGCTGCAGGAGG - Intergenic
942047859 2:172110264-172110286 CCAAACTTCAGTGCTGCAGGCGG - Intergenic
943968668 2:194373958-194373980 TCTAACTTTTGTTCTACAGCTGG + Intergenic
943968669 2:194373996-194374018 TCTAACTTTTGTTCTACAGCTGG - Intergenic
944322364 2:198362454-198362476 GAAAACTTTTTTGCTGCATCTGG - Intronic
944440659 2:199740271-199740293 GGAAACTTTTGAGATGGAGCAGG + Intergenic
1169185460 20:3612895-3612917 GCAGGCTTTTGTGCTGGAGATGG + Intronic
1171237037 20:23535402-23535424 GCCCACTTTCCTGCTGCAGCCGG + Intergenic
1172444975 20:34988157-34988179 GCACATGTTTGTGCTGGAGCAGG + Exonic
1172991273 20:39038754-39038776 GCATCCTTCTGTGCTGCAGCGGG + Exonic
1178233583 21:30815459-30815481 GCTAGGTTTTGTGCTGCAGAAGG - Intergenic
1183143926 22:35971829-35971851 GAAAACCTTTGTACTGTAGCAGG + Intronic
1183306937 22:37087640-37087662 GGAGACTTGGGTGCTGCAGCAGG - Intronic
957258022 3:77863729-77863751 CCAAAAATTTTTGCTGCAGCAGG - Intergenic
958093650 3:88911512-88911534 TCACAGTTTTGTGCTGAAGCTGG + Intergenic
959633369 3:108534132-108534154 GCAATCATTTGTGCAGCAGCTGG - Intergenic
962446844 3:135473574-135473596 GCAAAGTGGTGTCCTGCAGCAGG + Intergenic
962825024 3:139093336-139093358 TAAAACTTTTGTGCTTCAGAGGG - Intronic
963716133 3:148806057-148806079 ACTATCTTTTGTGCTGAAGCTGG - Intronic
964400582 3:156293631-156293653 GCTTACATTTGTACTGCAGCTGG - Intronic
965181926 3:165415044-165415066 GCACACTTGTCAGCTGCAGCGGG - Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
967861387 3:194154479-194154501 GCCATCTTTGGTGTTGCAGCTGG + Intergenic
968288736 3:197523062-197523084 GCAAACTTATGTGGGGCAGGCGG + Intronic
968686204 4:1960586-1960608 GCAACCTTTTGTGCTGTTGCTGG - Intronic
969415766 4:7057208-7057230 GAAAAACTTTGTGCTGAAGCAGG + Exonic
969481024 4:7446928-7446950 GGAAACCTTAGTCCTGCAGCAGG - Intronic
971304041 4:25464857-25464879 GCGACCTTCTGTCCTGCAGCAGG + Intergenic
971446161 4:26751318-26751340 GCCAAATTTTCTGCTCCAGCAGG - Intronic
972194342 4:36635334-36635356 TCAAACTTCTGTGCTGCTGCTGG - Intergenic
972600183 4:40565331-40565353 GCCAACCTTGGTGCTGGAGCTGG + Intronic
974723659 4:65773188-65773210 GCAAGCTTGTCAGCTGCAGCAGG + Intergenic
977627489 4:99203192-99203214 GCAGACTCTTCTGCTCCAGCTGG - Exonic
978916085 4:114127421-114127443 GAAAACTTGTGGGATGCAGCAGG + Intergenic
981099889 4:140818163-140818185 ATAAAGTTTTGTGCTTCAGCTGG - Intergenic
985877026 5:2607728-2607750 AAAATCTTTTGTGCTGTAGCAGG + Intergenic
989456432 5:41649424-41649446 GCTAACCTGTGTGGTGCAGCTGG + Intergenic
990104188 5:52236319-52236341 GTAAACTTTTGTGCTGTAGGAGG + Intergenic
991255961 5:64615165-64615187 GCAAACTGTTGTGGTCCAGCTGG + Intergenic
994818361 5:104614214-104614236 GCAAACTCTTGTGCTAAAGAAGG - Intergenic
995065872 5:107861922-107861944 GCTCACTGATGTGCTGCAGCTGG + Intronic
995258588 5:110075285-110075307 GCAAGCTTGTTGGCTGCAGCAGG + Intergenic
997001469 5:129766978-129767000 GAAAACATCTGTGCTGCATCAGG + Intergenic
1001780248 5:174362092-174362114 GAAAACTTTTGTGCTTCCACAGG + Intergenic
1003278536 6:4673068-4673090 GGACATTTCTGTGCTGCAGCGGG - Intergenic
1006391215 6:33759954-33759976 GCATCCTTTGGTGCTTCAGCAGG - Intergenic
1007214145 6:40223275-40223297 ACAATCTTTGCTGCTGCAGCAGG + Intergenic
1008109216 6:47474909-47474931 GCAATGTTTTGAGCTGCAGACGG + Intergenic
1021389475 7:20074000-20074022 GCAAATTTTTCGGCAGCAGCTGG + Intergenic
1021796397 7:24258677-24258699 GGAAAATTTTTTGCTGCAGAGGG + Intergenic
1028858978 7:95625974-95625996 ACAAACTTTTGTGCTGCAGAGGG + Intergenic
1029457124 7:100676969-100676991 GAGAACTTGTGGGCTGCAGCTGG + Intronic
1040857467 8:51962705-51962727 GCAAACTTTTGTCCTCCCTCAGG - Intergenic
1042576850 8:70230097-70230119 GAAAACTTTTGAGCTGAAGATGG + Intronic
1045903020 8:107307756-107307778 GAAATCTTTTGTGCCGCAGTTGG - Intronic
1047031420 8:120885903-120885925 ACAAAATTTTCTGCTGCAGTTGG + Intergenic
1047168629 8:122467354-122467376 GCATGCTCTTTTGCTGCAGCAGG - Intergenic
1050619691 9:7439926-7439948 GAATACTTTTCTGCTGCAGATGG - Intergenic
1054801173 9:69350057-69350079 GTAAACTTTTGTGCTTCAAAGGG - Intronic
1056141951 9:83690564-83690586 GTGAACTTTTAAGCTGCAGCAGG + Intronic
1203496481 Un_GL000224v1:156338-156360 GCAAACATTTGTACCACAGCAGG + Intergenic
1203509105 Un_KI270741v1:98260-98282 GCAAACATTTGTACCACAGCAGG + Intergenic
1186465067 X:9778811-9778833 GCAATGATTTGTGCTTCAGCAGG - Intronic
1187093294 X:16120036-16120058 TCAAATTTTAGTACTGCAGCAGG - Intergenic
1188493134 X:30756594-30756616 GCACACTTGTTAGCTGCAGCAGG - Intergenic
1191729024 X:64314292-64314314 GCATGCTTGTTTGCTGCAGCAGG + Intronic
1197481390 X:126991118-126991140 GCATACTTTTATGTTTCAGCAGG + Intergenic
1202090718 Y:21185920-21185942 GCTAACCTTTGTCCTGCTGCCGG + Intergenic