ID: 908111392

View in Genome Browser
Species Human (GRCh38)
Location 1:60902100-60902122
Sequence TGGGCTTCCCTGAGCATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908111388_908111392 3 Left 908111388 1:60902074-60902096 CCAAATATCTGTAAGCACAACTT 0: 1
1: 0
2: 1
3: 10
4: 208
Right 908111392 1:60902100-60902122 TGGGCTTCCCTGAGCATATCTGG 0: 1
1: 0
2: 0
3: 9
4: 153
908111387_908111392 9 Left 908111387 1:60902068-60902090 CCAAGACCAAATATCTGTAAGCA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 908111392 1:60902100-60902122 TGGGCTTCCCTGAGCATATCTGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908111392 Original CRISPR TGGGCTTCCCTGAGCATATC TGG Intronic
902377477 1:16036623-16036645 CGGGCCTCACTGAGCTTATCCGG + Intergenic
903468062 1:23566331-23566353 AGGGCTTCCCTGACCCTAACCGG + Intergenic
907383842 1:54112792-54112814 TGGGCTTCAGTCAGCACATCTGG - Intergenic
908111392 1:60902100-60902122 TGGGCTTCCCTGAGCATATCTGG + Intronic
910285434 1:85548942-85548964 TGGGGTACCCTGAAAATATCTGG + Intronic
913331838 1:117674198-117674220 TGAGCTTCCATGAGCTCATCTGG + Intergenic
915115799 1:153598742-153598764 GGTGCCTCCCTGAGCATATCAGG - Intergenic
915904532 1:159868090-159868112 AGGGCTCTCCTGAGCATTTCAGG - Intronic
916573537 1:166047847-166047869 TGGGCTTCCGTGGGCATTTGAGG + Intergenic
917176544 1:172242178-172242200 TGGGCTTCCCTGTCCCTACCAGG - Intronic
917223713 1:172759426-172759448 TGGTCTTCTCTGTGCATACCTGG - Intergenic
918074374 1:181159320-181159342 TGGGCTTGCTTGGGCATCTCAGG + Intergenic
918460681 1:184773570-184773592 TAGGCTTCCTTGACCATAGCAGG - Intergenic
920436456 1:205950080-205950102 TGGGATTCCCTGAGCAAAGTGGG + Intergenic
921563820 1:216691747-216691769 TGGCCTTCCCTGAGCTGACCTGG + Intronic
923470396 1:234285229-234285251 TGGGCTTCCCTCAGAAGATGAGG + Intronic
1063356333 10:5402469-5402491 AGGGCTCCCCTCAGCTTATCTGG - Intronic
1065436226 10:25706319-25706341 AGGGCCTCTCTCAGCATATCTGG - Intergenic
1066023560 10:31327940-31327962 TGGGTTTCCCTTTCCATATCTGG + Intronic
1069998867 10:72361251-72361273 AGAGCTTCCCTGAGCAAGTCAGG + Intergenic
1070494790 10:77011581-77011603 TGGGGGTCCCTGAGTATATAGGG - Intronic
1071430049 10:85600229-85600251 TAGGCTTCTCTGAGCATGCCTGG + Exonic
1074823382 10:117197948-117197970 TGGTCTTTCCTGAGCACCTCAGG - Intronic
1074947304 10:118293610-118293632 TCTGCTTCCCCGTGCATATCTGG + Intergenic
1075537659 10:123284360-123284382 TGGGCTGCCCTGGGCAGCTCAGG - Intergenic
1075572373 10:123555737-123555759 TGAGCATCCCTGGGCAAATCAGG - Intergenic
1075682716 10:124343937-124343959 TGTGGTTCCCTCAGCAAATCAGG + Intergenic
1077233397 11:1468662-1468684 TGGGCTTCTCAGAACATGTCTGG - Intergenic
1079596754 11:22259187-22259209 TGGCCTTGCCTGATCTTATCTGG - Intronic
1080420289 11:32103875-32103897 TGAGCTTGCCTGAGGATGTCTGG - Intronic
1080765825 11:35295916-35295938 TGGGCTTACCTGAGCTTACCTGG + Intronic
1081537669 11:44007193-44007215 GGGGCCTCCCTGGGCAGATCTGG - Intergenic
1081867078 11:46366022-46366044 TGGGCTCCCCTGAGCACCCCTGG + Intronic
1082121317 11:48383032-48383054 TGGGACTCCCTGAGCATTTGGGG - Intergenic
1083690723 11:64406913-64406935 AGGGCTTGGCTGAGCATCTCTGG + Intergenic
1086143485 11:83524750-83524772 TTGGCTTCCCTGAGCACACCGGG + Intronic
1089491145 11:118885111-118885133 CGGGCTTCTCTGAGCAAGTCTGG - Intronic
1089633524 11:119797812-119797834 TGGGCTGCCATAAGCATACCTGG + Intergenic
1089964255 11:122642783-122642805 AGTGCTTCTCTGAGCGTATCTGG - Intergenic
1092279651 12:7089700-7089722 TGTGCTTCCCGGAGCAAATCAGG - Exonic
1093654810 12:21682291-21682313 TGAGGTTCCCAGAACATATCTGG - Intronic
1097334140 12:58363403-58363425 TGGGCTTCCCAGGACATGTCAGG + Intergenic
1099111400 12:78566382-78566404 GGGGTTTCACTGAGCAGATCTGG - Intergenic
1099618526 12:84971704-84971726 GGGACTTCCTTGAGCATTTCAGG - Intergenic
1107010968 13:35670544-35670566 TTGGCTTCTCTGAGGATATCTGG - Intronic
1107321675 13:39195576-39195598 TTAGCTTCCCTGACCGTATCTGG - Intergenic
1107810999 13:44199535-44199557 TGGGCATCACTTAGCATAGCTGG + Intergenic
1109164504 13:59017035-59017057 TGGACTCCCTTGAGCATTTCAGG + Intergenic
1109179955 13:59201965-59201987 AGGGCTCCACTGAACATATCTGG + Intergenic
1116029019 14:39548722-39548744 TTGTCTTCCCTGATCATCTCAGG - Intergenic
1116929375 14:50674563-50674585 TGTGCTTCCATGAGCATCTTAGG - Intergenic
1118901519 14:69990104-69990126 TGGGCTTCTCTGACTACATCTGG + Intronic
1119149278 14:72343430-72343452 TGTGATTCACTGAGCATACCTGG + Intronic
1120880104 14:89409003-89409025 TGGGTGTACCTGAGCATACCTGG + Intronic
1121448207 14:93991721-93991743 TGGCCTTCCCTGACCATCTCAGG - Intergenic
1123110084 14:105863131-105863153 TGGGGTTTCCTGAGCATTGCAGG - Intergenic
1123784824 15:23660595-23660617 TGGGATTCACTGAGCGTATTGGG + Intergenic
1126152248 15:45533760-45533782 TGGATTTCTCTAAGCATATCTGG + Intergenic
1129048543 15:72758393-72758415 TGGGCTTCTCTGGGGAGATCTGG + Intronic
1130829382 15:87584019-87584041 AGAGCTTCTGTGAGCATATCAGG + Intergenic
1132857894 16:2055226-2055248 TGGGCTCCCCTGAGCCTCTTCGG + Intronic
1137515245 16:49137876-49137898 TGGGCTGCACTGAGCTTATCTGG - Intergenic
1137737721 16:50737291-50737313 TGCTGTTCCCTGAGCATACCAGG + Intergenic
1138387030 16:56642983-56643005 TGGGCTTCCCACAGCCTAGCTGG - Intronic
1139714024 16:68798376-68798398 TGAGCTTCCCAGAGCCTTTCTGG + Intronic
1144463584 17:15478551-15478573 TTGGCTTCCCTGAGCAACACTGG + Intronic
1146682791 17:34820643-34820665 TGGGCTGCGCTGAGCATAGGAGG - Intergenic
1151758111 17:76086249-76086271 TGGGCTTCCTTGGGCAGAGCTGG + Intronic
1153715785 18:7846664-7846686 TGCGCTTCCCTAGGCAAATCAGG - Intronic
1155366820 18:25057188-25057210 TAGGCTTCCCAGAGCAGCTCTGG - Intergenic
1160700254 19:503007-503029 TGGGCTTACCCAGGCATATCTGG - Intronic
1161572935 19:5040230-5040252 AGGGCTTCCCAGTGCATGTCGGG + Intronic
1162282361 19:9709450-9709472 TGGGCATGCCTGAGCACAGCAGG - Intergenic
926366707 2:12139998-12140020 TGGGCTTCACTTGGCACATCTGG + Intergenic
926751616 2:16202808-16202830 TGGGCATCCCTCTCCATATCTGG + Intergenic
928968499 2:37001540-37001562 TTGGCTTCCCTGAGCCTCACTGG + Intronic
935301353 2:101696933-101696955 TGGGATTCGCTGAGCATCGCTGG - Intronic
936276297 2:111100674-111100696 TGGGCTTCACCTAGCAAATCAGG - Intronic
937252276 2:120532514-120532536 TGGCCTTCCCTGGGCTTTTCTGG - Intergenic
937346500 2:121129404-121129426 CAGGCTTCCCTGAGCAGGTCAGG + Intergenic
943420666 2:187664428-187664450 TGAGCATCTCTGAGCACATCAGG - Intergenic
948160216 2:235817203-235817225 TGGGCCTTCCTGACCATTTCTGG - Intronic
1169847527 20:10010761-10010783 TGAGCTTTCCTGAGTATATAGGG + Intronic
1170260714 20:14404285-14404307 TGTGCTTCCTTAATCATATCTGG - Intronic
1170456479 20:16538154-16538176 TGGGCTTCTCTGAGGTTCTCTGG - Intronic
1172076551 20:32302709-32302731 AGGTCTTCCCAGAGGATATCAGG + Intronic
1173224052 20:41151578-41151600 GAGGTTTCCCTGAGCACATCTGG - Intronic
1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG + Intergenic
1174697014 20:52570186-52570208 TGGCCTTCCCTGGGCATGTTAGG + Intergenic
1175179282 20:57133942-57133964 AGGGCTTCACTGAGCATCACTGG - Intergenic
1177783530 21:25644560-25644582 TGGGCTTACCTGAGTAACTCTGG + Intronic
1181325132 22:22039001-22039023 CAGGCTTCGCTGAGCATTTCTGG + Intergenic
1181368618 22:22398949-22398971 ATGGCATCCCTGAGCATCTCTGG + Intergenic
1181372018 22:22426194-22426216 GAGGCCTTCCTGAGCATATCTGG + Intergenic
1181391836 22:22588605-22588627 ATGGCTTCCCTGACCATCTCTGG + Intergenic
1182081109 22:27529417-27529439 TGGTCTTCTATGAGCTTATCAGG - Intergenic
1183116168 22:35694255-35694277 TCGGCTTCCCTGAATATCTCCGG - Intergenic
950669938 3:14519970-14519992 TGAGCTTCCCTGGGCAAATGAGG + Intronic
950767063 3:15280731-15280753 TGGGTTTCCCTGAGCTCAGCAGG + Intronic
954814582 3:53270521-53270543 TGGGTTTCCCTGAGCAAGGCTGG + Intergenic
955760316 3:62273029-62273051 TGGGATTCCTGAAGCATATCAGG + Exonic
961175760 3:124833950-124833972 TGGACTTCCCTGAGTAGGTCAGG - Intronic
967733022 3:192923537-192923559 TTTGCTTCCCTGAGTATAGCAGG - Intergenic
968217709 3:196907661-196907683 TTGGCTTCCCTGAGCCTCACTGG + Intronic
972223156 4:36979691-36979713 TGGTCTTCCTTGAACACATCAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
980140691 4:128912969-128912991 TGTGATTTGCTGAGCATATCTGG + Intronic
980582569 4:134773449-134773471 TAGGCATCCCTGAGCATTTGGGG + Intergenic
982975121 4:162047078-162047100 TGGGCTTACCTGGGGGTATCTGG - Intronic
983684642 4:170393989-170394011 TGGGCTTCCCTGTTGAGATCAGG + Intergenic
985524509 5:395162-395184 TGGGGTTCCCTCAGCTTTTCTGG + Intronic
985874746 5:2586171-2586193 TTGGCTGCCCAGAGCATTTCTGG - Intergenic
986658815 5:10040943-10040965 TGGGCTAGCCTGAGCCAATCTGG - Intergenic
986730928 5:10634386-10634408 AGGGCTTCTCTGAGGATTTCAGG + Intronic
989644971 5:43621334-43621356 TTGGCTTCCCTGAGCAACACTGG - Intronic
990641146 5:57784903-57784925 TAGACTTGCCTGAGCATATGTGG + Intergenic
995494689 5:112728465-112728487 TTGGCTTCCCTGAGCAACACTGG - Intronic
996193696 5:120577521-120577543 TGGTGTTCCCTGAAAATATCAGG - Intronic
998104715 5:139461250-139461272 TGGCCTTCATTGAGCATGTCAGG - Intronic
1000218765 5:159191005-159191027 TCGGTTTCCCTGAGCCTAACTGG + Intronic
1000935544 5:167300817-167300839 TGGGCTTCCCTGACTATTCCTGG - Intronic
1001251420 5:170149773-170149795 TGGGCTTCCCTGACCAGGCCAGG + Intergenic
1003249747 6:4415804-4415826 TGGGCATCTCTGAGGATATGGGG - Intergenic
1006193130 6:32221560-32221582 TGGCCTTGCCTGAGAAAATCTGG + Intronic
1006745761 6:36340940-36340962 TGAGATTCACTGAGCATTTCCGG - Intergenic
1007206242 6:40153962-40153984 TGTCCTTCTCTGAGCAAATCTGG - Intergenic
1009719204 6:67443851-67443873 TTGGCTTCCCTGAGCCAATTTGG + Intergenic
1010642878 6:78352283-78352305 TGGGCTACCTTGAGGATATTTGG - Intergenic
1012176189 6:96087883-96087905 AGGGCTTCCTTTAACATATCTGG + Intronic
1012837964 6:104294327-104294349 TGGGCTCCACTGAGTTTATCTGG + Intergenic
1013750906 6:113405013-113405035 TGCGCCTCCCTGAGGACATCTGG - Intergenic
1014769482 6:125444892-125444914 TGTGCTTGCCTGTGCAAATCTGG - Intergenic
1016609739 6:145975009-145975031 TGGGCTCCCCTGTGCATTGCAGG + Intergenic
1017979483 6:159387167-159387189 TGGTCTTTTCTGAGCATTTCAGG - Intergenic
1021058059 7:16075318-16075340 TGGACTTCTCTGTGCAAATCCGG + Intergenic
1023837771 7:44078564-44078586 TTGGCTGCCTTGTGCATATCAGG + Intronic
1024281186 7:47721154-47721176 TGGGCCTCCGTGAGCAGAACTGG + Intronic
1024876367 7:54028737-54028759 TGGGTTTGCCTGTGCATATCTGG - Intergenic
1036226101 8:6958802-6958824 TGAGTTTCCCTGAGCAGTTCTGG - Intergenic
1036254635 8:7195480-7195502 GGGGGTTCCCTGTGCATTTCAGG - Intergenic
1036362856 8:8092008-8092030 GGGGGTTCCCTGTGCATTTCAGG + Intergenic
1036888105 8:12575065-12575087 GGGGGTTCCCTGTGCATTTCAGG - Intergenic
1036895708 8:12633180-12633202 GGGGGTTCCCTGTGCATTTCAGG - Intergenic
1037490592 8:19393736-19393758 TGGGGTTCCCTGAGTATTTAAGG - Intronic
1037627924 8:20624286-20624308 TGGGCTTCCCTCAGCCTTTAGGG + Intergenic
1040035042 8:42861750-42861772 TGGGTTGCCCTGAGAATCTCCGG + Exonic
1048593522 8:135843548-135843570 TGGGCCTCCCTGAGCTGAGCTGG - Intergenic
1049352580 8:142172005-142172027 TGGGCTTCCCGGGGCAGATCTGG - Intergenic
1051799738 9:20919058-20919080 TGGGCTTACATGAACAAATCAGG - Intronic
1053409492 9:37906355-37906377 AAGGCTTCCCTGATCATCTCAGG + Intronic
1055429564 9:76229944-76229966 TGAGCTTGCCTGGGCATCTCAGG + Intronic
1059702517 9:116789398-116789420 TGGGCTCCTCTGAGGATCTCAGG + Intronic
1060150791 9:121286963-121286985 TGGGCTTCTATGAGCATAGGAGG + Intronic
1060512052 9:124241351-124241373 TGAGCTTCCCTGAGCTTCCCTGG + Intergenic
1061160693 9:128892327-128892349 TGGGCTTCCCCCAGCAGCTCCGG - Intronic
1062090713 9:134677377-134677399 TGGGTTCCACTGAGCATTTCAGG + Intronic
1062194720 9:135266644-135266666 AGGGCTTCCCTGAGCAAAGGCGG + Intergenic
1189358687 X:40331304-40331326 TCGGCTTCCCTGAGCAGTGCTGG + Intergenic
1190528297 X:51349963-51349985 TTGGATTCCCTGAACACATCTGG - Intergenic
1195747206 X:108130854-108130876 CTGGCTTCCCTGAGAATTTCAGG + Intronic
1197135896 X:123059316-123059338 AGGGCTTCCTAGAGCATTTCTGG + Intergenic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1202099813 Y:21295366-21295388 TGGGCATGCCTGAGCACAGCAGG - Intergenic