ID: 908111524

View in Genome Browser
Species Human (GRCh38)
Location 1:60903391-60903413
Sequence TACCTCATGGGCTTGATGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908111524_908111530 14 Left 908111524 1:60903391-60903413 CCTCGCATCAAGCCCATGAGGTA 0: 1
1: 0
2: 1
3: 38
4: 334
Right 908111530 1:60903428-60903450 TTTCACAGATAAGTAAACAGAGG 0: 1
1: 7
2: 186
3: 1492
4: 6303
908111524_908111531 21 Left 908111524 1:60903391-60903413 CCTCGCATCAAGCCCATGAGGTA 0: 1
1: 0
2: 1
3: 38
4: 334
Right 908111531 1:60903435-60903457 GATAAGTAAACAGAGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908111524 Original CRISPR TACCTCATGGGCTTGATGCG AGG (reversed) Intronic