ID: 908112103

View in Genome Browser
Species Human (GRCh38)
Location 1:60908163-60908185
Sequence AAGAAGAAAGGGTCTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908112099_908112103 2 Left 908112099 1:60908138-60908160 CCCTAAAATCACTGGTCAATTGA No data
Right 908112103 1:60908163-60908185 AAGAAGAAAGGGTCTCATGAAGG No data
908112100_908112103 1 Left 908112100 1:60908139-60908161 CCTAAAATCACTGGTCAATTGAA 0: 1
1: 0
2: 3
3: 16
4: 232
Right 908112103 1:60908163-60908185 AAGAAGAAAGGGTCTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908112103 Original CRISPR AAGAAGAAAGGGTCTCATGA AGG Intronic
No off target data available for this crispr