ID: 908112997

View in Genome Browser
Species Human (GRCh38)
Location 1:60915681-60915703
Sequence CAGTTCACACAGGTGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 544}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908112997_908113003 0 Left 908112997 1:60915681-60915703 CCTCCTACCACCTGTGTGAACTG 0: 1
1: 0
2: 2
3: 63
4: 544
Right 908113003 1:60915704-60915726 GGTTGAGTTATTTCCCTCTCTGG No data
908112997_908113008 27 Left 908112997 1:60915681-60915703 CCTCCTACCACCTGTGTGAACTG 0: 1
1: 0
2: 2
3: 63
4: 544
Right 908113008 1:60915731-60915753 TCATATTTTCAGCTATAAAGTGG 0: 1
1: 0
2: 4
3: 39
4: 475
908112997_908113004 1 Left 908112997 1:60915681-60915703 CCTCCTACCACCTGTGTGAACTG 0: 1
1: 0
2: 2
3: 63
4: 544
Right 908113004 1:60915705-60915727 GTTGAGTTATTTCCCTCTCTGGG 0: 1
1: 0
2: 0
3: 28
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908112997 Original CRISPR CAGTTCACACAGGTGGTAGG AGG (reversed) Intronic
900603326 1:3512506-3512528 CAGTTCCCACGTGTGGTGGGAGG + Intronic
900941671 1:5802449-5802471 AAGGTCACACAGCTGGTAAGTGG - Intergenic
901380732 1:8872095-8872117 TAATTCACACAGCTGGTAGGAGG - Intronic
901406881 1:9055153-9055175 AAGATCACACAGCTGGGAGGTGG - Intronic
901741470 1:11344913-11344935 AAGTTCACACAGCTAGTAAGAGG + Intergenic
902189871 1:14754828-14754850 AAGGTCACACAGCTGGCAGGTGG - Intronic
902371256 1:16008490-16008512 CAGATCAGAAAGGTGGCAGGAGG + Exonic
902761625 1:18584598-18584620 AAGGTCACACAGCTGGTAAGTGG + Intergenic
903154695 1:21435846-21435868 CAGGTCACACAGTTGATGGGAGG - Intergenic
903414910 1:23175932-23175954 AAGGTCACACAGCTGGTAAGTGG + Intronic
903420654 1:23216426-23216448 GAGATCACACAGCTAGTAGGTGG + Intergenic
903465441 1:23549415-23549437 AAGTTCACACAGCTAGTATGTGG + Intergenic
904403743 1:30273204-30273226 CAGTGAACACTGGTGGGAGGGGG + Intergenic
904798404 1:33074932-33074954 AAGATCACACAGCTGGTAAGTGG - Intronic
904812319 1:33171432-33171454 AAGTTCACACAGCTAGTAAGAGG + Intronic
904939560 1:34155933-34155955 CTGTTCACATAGGTGGTTAGGGG + Intronic
905109789 1:35586957-35586979 GAGATCACACAGCTGGTAGACGG - Intronic
905270047 1:36781808-36781830 AAGGTCACCCAGCTGGTAGGAGG - Intergenic
905451188 1:38057699-38057721 CTGGTCACACAGCTGGTAAGAGG - Intergenic
905530906 1:38677956-38677978 GTGTTCACATAGCTGGTAGGTGG - Intergenic
906376364 1:45299813-45299835 CAAGTCACACAGGTGTTAAGTGG - Intronic
907048550 1:51314761-51314783 CAGGTCACACAGCTGGTAGCTGG - Intronic
907473941 1:54692919-54692941 CAGGTCACACAGGTGGCAAGTGG - Intronic
907560725 1:55385181-55385203 AAGGTCACACAGCTGGTAAGTGG - Intergenic
907928002 1:58972804-58972826 AAGTTCACACAGTTGGGAAGAGG + Intergenic
908112997 1:60915681-60915703 CAGTTCACACAGGTGGTAGGAGG - Intronic
908170951 1:61504194-61504216 GAGTTCACACAGCTGTTAAGTGG + Intergenic
908358003 1:63340955-63340977 CAAGTCACACAGCTAGTAGGTGG - Intergenic
908917383 1:69145097-69145119 AATTTCACACAGCTGGTAGAAGG + Intergenic
909056428 1:70826320-70826342 CAGGTCACACAGTTTGTGGGTGG + Intergenic
909590531 1:77343593-77343615 AAAGTCACACAGGTGGTAGGTGG - Intronic
909701613 1:78530853-78530875 AAGTTCACACTGCTGGTAAGTGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
912327216 1:108778505-108778527 CAAATCACACAGGTAGTAAGAGG - Intronic
913255401 1:116948820-116948842 AAGGTCACACAGCTGATAGGTGG - Intronic
915276044 1:154788912-154788934 AAGGTCACACAGCTGGTAAGTGG + Intronic
915320534 1:155053686-155053708 CAGGTCACACAGCTAGTATGTGG + Intronic
916002576 1:160631258-160631280 CAGATCACACAGCTGGTTTGTGG - Intronic
918048992 1:180958100-180958122 AAGGTCACACAGGTGGTGAGAGG - Intergenic
918094099 1:181320596-181320618 AAGTTCACCCAGCTAGTAGGAGG + Intergenic
920032823 1:203047800-203047822 AAGGTCACACAGGTGGTAAGAGG + Intronic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
921106976 1:211991313-211991335 CAGATCACAGAGTTGGTAGGTGG - Intronic
921477842 1:215631937-215631959 CAGTAGAAACAGGTGGTGGGAGG - Intronic
921808205 1:219479967-219479989 TCATTCACACAGGTGGTAGAAGG + Intergenic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922819823 1:228476586-228476608 CAGTTCAAACAGGAGCTGGGAGG + Intergenic
922945121 1:229507775-229507797 CAGATCACACGGGTAGTAGGTGG + Intronic
923711473 1:236390912-236390934 AAGAGCACACAGGTGGTAAGTGG - Intronic
924197665 1:241624858-241624880 AAGATCACACAGCTGGTAAGTGG - Intronic
924516109 1:244767808-244767830 AAGTTCCCCCAGGTGCTAGGTGG + Intergenic
924564929 1:245189631-245189653 GGGATCACACAGGTGGTAGGGGG - Intronic
1063002306 10:1936007-1936029 CAGGTCACACAGCAAGTAGGTGG - Intergenic
1063189753 10:3682274-3682296 CAGGTCACACAGCAGGCAGGCGG + Intergenic
1064016124 10:11773693-11773715 CAGCTCACACAGGTAGTTGTCGG - Intergenic
1064337619 10:14458074-14458096 CAATTCCCACATGTGGTGGGAGG + Intronic
1065263883 10:23955159-23955181 AAGTTCACAGAGGGGGTAAGCGG + Intronic
1065375465 10:25036163-25036185 TAGTTCCCACATGTTGTAGGAGG + Intronic
1065420105 10:25533858-25533880 CAGGTCACATAGCTGGTAAGTGG - Intronic
1065974284 10:30829010-30829032 CAGTTCACACGGATAGTAAGTGG + Intronic
1068059815 10:52052781-52052803 TAATTCCCACAGGTTGTAGGAGG - Intronic
1068320500 10:55407928-55407950 CAATTCATACAGGATGTAGGTGG + Intronic
1068448914 10:57161787-57161809 CAGTGCACGCAGGCAGTAGGTGG - Intergenic
1068928772 10:62567260-62567282 AAGATCACACAGCTAGTAGGTGG + Intronic
1069583319 10:69579652-69579674 AAGTTCGCACAGATGGTGGGTGG - Intergenic
1069753130 10:70757621-70757643 CAGTGCATGCAGGTGGTAGTAGG + Intronic
1069828336 10:71267926-71267948 CAGATCACACAGCAGTTAGGAGG - Intronic
1069899453 10:71698895-71698917 AAGGTCACACAGCTGGTAAGTGG - Intronic
1070803047 10:79254731-79254753 CAGTTTAGACAGGTGGGCGGGGG + Intronic
1071715956 10:88095645-88095667 AAGTTCACACGGCTGGTAGCAGG + Intergenic
1071732369 10:88261252-88261274 GAGGTCACCCAGGTGGTAGGTGG - Intergenic
1071734429 10:88282441-88282463 TATTTCACAGAGGTGTTAGGAGG + Intronic
1072312869 10:94173143-94173165 AAGATTACACAAGTGGTAGGTGG + Intronic
1074297465 10:112203824-112203846 AAGGTCACACAGGGAGTAGGTGG + Intronic
1074390529 10:113053885-113053907 AAGGTCACACAGCTGGGAGGCGG + Intronic
1074419138 10:113293777-113293799 AAGATCACACAGCTGGTAAGCGG - Intergenic
1074904464 10:117849117-117849139 TAGTTCACACAGCTAGTAGGAGG - Intergenic
1075394431 10:122116472-122116494 AAGGTCACACAGCTGGTAAGGGG - Intronic
1075576762 10:123583353-123583375 AAGTTCACACAGTTGGTAAGAGG + Intergenic
1076399916 10:130175752-130175774 CAGAGCACACAGGTGTTAGTTGG - Intronic
1077044539 11:538575-538597 CTGTTGACAGAGGTGGTGGGTGG - Intronic
1079167748 11:18062174-18062196 ATGTTCACACAGGTAGTAAGTGG - Intergenic
1079226109 11:18606189-18606211 CAGTTCTCTAAGCTGGTAGGGGG + Intergenic
1079467210 11:20742299-20742321 GAGTTCAAAGAGGTAGTAGGGGG + Intronic
1079659606 11:23021697-23021719 CAGTTCTCAGAGGTGGTAAAAGG + Intergenic
1080762812 11:35268940-35268962 CAGATCACACAGTTAGTAGGTGG - Intronic
1081224242 11:40501121-40501143 CAGGTCACACTGGTGCAAGGGGG + Intronic
1081533107 11:43977816-43977838 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1081977181 11:47243035-47243057 CAGTTCAAATATGTGGCAGGAGG + Exonic
1082078266 11:47991738-47991760 AAGGTCACACAGGTAGGAGGTGG - Intronic
1083412011 11:62500398-62500420 CAGTTCACACAGGTGCTAGAAGG + Intronic
1083747942 11:64745507-64745529 CAGTTCACACAGGAGGAACGGGG + Intergenic
1084194912 11:67519010-67519032 CACTGCACACAGGTGGGATGGGG + Exonic
1084198988 11:67542925-67542947 AAGTTCACATAGCTGGTAAGAGG + Intergenic
1084287646 11:68142357-68142379 CAAATCACACAGTTGGGAGGTGG + Intergenic
1084686519 11:70699025-70699047 CAGCTCACAGAGGAGGCAGGAGG + Intronic
1085029765 11:73264009-73264031 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1085035320 11:73296558-73296580 CGGTAGACACAGGTGGTGGGTGG - Exonic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1085250795 11:75142378-75142400 AAGGTCACACAGTTGGTAAGAGG - Intronic
1085389465 11:76175145-76175167 CAGATCACACCGGGGGTTGGGGG + Intergenic
1085473075 11:76770451-76770473 CAGTTCACAGAGCTAGTAAGTGG - Intergenic
1085491149 11:76918805-76918827 AAGTTCACACAGCTAGAAGGTGG + Intronic
1085693807 11:78687138-78687160 CAGTTCACACAGGTGGGAACTGG + Intronic
1086278978 11:85163660-85163682 CATTCCACATAGGTAGTAGGTGG - Intronic
1086314780 11:85579964-85579986 CAATTCACACATGTTGTGGGAGG + Intronic
1086938242 11:92767478-92767500 CAGGGCACATGGGTGGTAGGTGG - Intronic
1087251329 11:95903737-95903759 CAGTGCACACAGGTTATAGTTGG - Intronic
1087273358 11:96135498-96135520 AAGTTCACTCAGCTAGTAGGTGG + Intronic
1088046278 11:105456299-105456321 AAGCTCACACAGGTAGTAAGTGG - Intergenic
1088296983 11:108309496-108309518 AAGATCACACAGCTGGTAGTAGG + Intronic
1088777075 11:113095820-113095842 AAGGTCACACAGTCGGTAGGAGG - Intronic
1088831813 11:113543305-113543327 GAGGTCACACAGCTGGTAAGTGG + Intergenic
1089259251 11:117211830-117211852 CAGTTCTCACAGCTAGTAAGTGG - Intronic
1089633453 11:119797445-119797467 TAGGTCACACACGTGGCAGGAGG + Intergenic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1091589049 12:1832232-1832254 AAGATCACACAGCTGGCAGGTGG - Intronic
1091815330 12:3433528-3433550 AAGATCACACAGCTGGTAAGTGG + Intronic
1092563109 12:9637219-9637241 CAGTTCACACAGGGAGATGGAGG + Intergenic
1094101863 12:26773141-26773163 CAAATCACATAGATGGTAGGTGG - Intronic
1094440604 12:30471670-30471692 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1094648258 12:32348932-32348954 CAGCACACACAGGTAGAAGGTGG - Intronic
1095956638 12:47810314-47810336 GAGGTCACACAGATGGTATGTGG + Intronic
1096530294 12:52238371-52238393 CAGGTCACACGGTTAGTAGGTGG + Intronic
1098165662 12:67695058-67695080 CAGGTCACACAGCCAGTAGGTGG + Intergenic
1098206235 12:68113385-68113407 CAGAACACACAGCTGGTTGGTGG + Intergenic
1099939206 12:89164881-89164903 AACTTCACACAGGTGGTTGCTGG - Intergenic
1099939216 12:89164962-89164984 AACTTCACACAGGTGGTTGCTGG - Intergenic
1100373759 12:93993442-93993464 GAGATCACACAGCTGGTAAGTGG - Intergenic
1100972088 12:100080886-100080908 CAATTCCCACATGTTGTAGGAGG + Intronic
1101164097 12:102010237-102010259 CAGTTCCCAGATGGGGTAGGGGG + Intronic
1101242312 12:102850644-102850666 CAGGTCACACAGCTGGTTAGTGG + Intronic
1101671814 12:106882594-106882616 AAGATCACACAGCTGGTAAGTGG + Intronic
1101840486 12:108324340-108324362 AAGGTCACACAGCTGGTAAGCGG - Intronic
1102019662 12:109673366-109673388 AAGATCACACAGCTGGTAAGTGG - Intergenic
1102198688 12:111042515-111042537 AAGGTCACACAGCTGGTAAGTGG - Intronic
1102224699 12:111219768-111219790 CAGATCACACAGCTAGTAAGTGG - Intronic
1102244535 12:111347271-111347293 CAGGTCACACAGCTAGTAAGTGG - Intronic
1102338907 12:112106585-112106607 GAGGTCACACAGATGGTAAGTGG - Intronic
1102429858 12:112874825-112874847 AACGTCACACAGGTGGAAGGAGG + Intronic
1102454516 12:113063396-113063418 CAGTTCACACAGCTGGACAGAGG + Intronic
1102774501 12:115506906-115506928 CAGATCACAGAGGTGCTAGGAGG - Intergenic
1102943922 12:116968592-116968614 CATTTCACACAAGTGCAAGGAGG + Intronic
1103168402 12:118790989-118791011 CAGGTCACACAATTGGGAGGTGG + Intergenic
1103210955 12:119166044-119166066 CAGGTCACACAGATAGTAAGTGG + Intergenic
1103220141 12:119237375-119237397 AAGTTCACAGAGGTGGTAAATGG + Intergenic
1103403748 12:120660432-120660454 CAGATCACAGAGCTGGTAAGAGG - Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1104031431 12:125067861-125067883 CTGATCACACAGCTGGTAAGTGG - Intronic
1104484382 12:129137453-129137475 AAGGTCACACTGGTGGTAAGCGG + Intronic
1105212699 13:18266757-18266779 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1105529328 13:21203908-21203930 CAGTACACACAGGATGTAGCTGG - Intergenic
1105644195 13:22299430-22299452 TCTTTCACACAGGTGGGAGGTGG - Intergenic
1106859578 13:33890791-33890813 AAGGTCACACAGCTTGTAGGTGG + Intronic
1107012003 13:35678921-35678943 CCAACCACACAGGTGGTAGGTGG + Intergenic
1107332165 13:39312709-39312731 AAGTCAACACAGGTGGTAGGTGG + Intergenic
1107443542 13:40449519-40449541 GAGTTCACACAGCTGGTGAGTGG - Intergenic
1107678370 13:42819942-42819964 CAGTTCTCACATGTTGTGGGAGG - Intergenic
1107790733 13:43999626-43999648 AAGGTCACACAGCTGGTAGTAGG + Intergenic
1108783788 13:53869509-53869531 CAAGTCACACAGGTAGTAAGTGG + Intergenic
1108788982 13:53943292-53943314 TAGTTCCCACATGTTGTAGGAGG - Intergenic
1109667472 13:65558393-65558415 CAATTCCCACATGTGGTGGGAGG - Intergenic
1109881306 13:68480975-68480997 TAGGTCACACAGTTGGTATGTGG - Intergenic
1110087695 13:71403141-71403163 TAGGTCACACAGGTAGAAGGTGG - Intergenic
1110386470 13:74917498-74917520 CAGTTCACAGAGCTGGTAAAAGG + Intergenic
1110686749 13:78384522-78384544 AAGGTTACACAGCTGGTAGGTGG + Intergenic
1111650946 13:91090710-91090732 CAGGTCACACAGCTGGTGAGAGG - Intergenic
1112008381 13:95273690-95273712 CAGTTCCCACATGTTGTGGGAGG + Intronic
1112153898 13:96796432-96796454 CAGCTCAGACTAGTGGTAGGAGG + Intronic
1112228260 13:97562321-97562343 AAGATCACACAGCTAGTAGGTGG - Intergenic
1114766127 14:25372786-25372808 CAAGTCACACAGTTGGTAGGTGG + Intergenic
1115810774 14:37104739-37104761 AAGATCACACAGGTAGGAGGTGG + Intronic
1116001211 14:39244441-39244463 AAGTTCACAGAGGTAGTAGATGG + Intronic
1116095153 14:40358559-40358581 CAATTCCCACATGTAGTAGGAGG + Intergenic
1117208367 14:53469517-53469539 CAGTGCACACAGGTGGTAACCGG - Intergenic
1117475397 14:56089385-56089407 AAGGTCACACAGCTAGTAGGTGG - Intergenic
1117584728 14:57189280-57189302 CACTTCTCATAGATGGTAGGAGG - Intergenic
1118550347 14:66943132-66943154 AAGTTCAAACAAGTGGTAGAAGG - Intronic
1118595010 14:67428543-67428565 CAAGTCACACAGCTGGTACGTGG + Intergenic
1118914451 14:70090755-70090777 CAGCTCACACAAGTGGGATGCGG - Intronic
1119167341 14:72505695-72505717 AAGGTCACACAGCTGGTAGGTGG - Intronic
1119397028 14:74334049-74334071 AAGTTCACACAAGTAGTAAGTGG + Intronic
1119761481 14:77155070-77155092 CAGGTCACCCAGCTTGTAGGTGG + Intronic
1119874881 14:78050277-78050299 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1120503523 14:85325896-85325918 CAATTGAAACAGCTGGTAGGAGG - Intergenic
1120643889 14:87048809-87048831 AAGTTCACACTGCTGGTAAGTGG + Intergenic
1121288095 14:92752190-92752212 CAGCTCACACAGCTTGTAAGTGG - Intergenic
1121643596 14:95502404-95502426 CAGGACACACAGGCTGTAGGCGG - Intergenic
1121658096 14:95613197-95613219 CAGGTCACAGAGCTGGTAAGAGG + Intergenic
1122445750 14:101767263-101767285 CAGGTCGCATAGGTGCTAGGCGG + Intronic
1122981661 14:105194958-105194980 GAGTTCACACAGGTGAAAGGAGG - Intergenic
1125836791 15:42759081-42759103 AAGCTCACACAGGTGGCTGGTGG + Intronic
1126136099 15:45393348-45393370 AAGTTCACACAGCTAGTAAGTGG - Intronic
1126670472 15:51111073-51111095 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1127325424 15:57890117-57890139 AAGTTCACACAAGTAGTAAGAGG + Intergenic
1127433543 15:58934814-58934836 ATGTTCACACAGCTGGTATGTGG + Intronic
1127688155 15:61368663-61368685 CAGTTCACACAGATGTGGGGAGG - Intergenic
1128015578 15:64342224-64342246 AAGTTCACACTGCTGGTATGTGG - Intronic
1129316922 15:74750690-74750712 CAGGTCACACAGCTGGTCTGAGG - Intronic
1129512334 15:76133613-76133635 CAGGTCACAGAGCTAGTAGGTGG + Intronic
1129693540 15:77727834-77727856 AAGGTCACACAGCTGGCAGGTGG + Intronic
1129880059 15:79000411-79000433 AAGGTCACACAGCTAGTAGGGGG - Intronic
1130202147 15:81842037-81842059 CAGCTTACACAGGTGGTAAGTGG - Intergenic
1130297382 15:82656813-82656835 CAGCACACACAGGTGGAAGCAGG - Intergenic
1130393436 15:83479808-83479830 AAGATCACAGAGCTGGTAGGTGG - Intronic
1130509036 15:84573130-84573152 AAGTTCACACAGCTGGAGGGTGG - Intergenic
1132338881 15:101065737-101065759 CCGGGCACACAGCTGGTAGGTGG - Exonic
1133105044 16:3501986-3502008 CAGGTGATACAGGCGGTAGGAGG + Intronic
1133241567 16:4417040-4417062 CAGGTCACACCAGTGGTAAGAGG + Intronic
1133518237 16:6530845-6530867 CAATTCCCACATGTTGTAGGAGG - Intronic
1133603058 16:7358744-7358766 AAGTAGTCACAGGTGGTAGGTGG + Intronic
1133703034 16:8326693-8326715 TAGTAGACACAGGTGGCAGGAGG - Intergenic
1133815239 16:9192356-9192378 CAGTTCAGAAGGGTGGTGGGGGG + Intergenic
1133849761 16:9491456-9491478 AAGTTCACACAGCTTGCAGGTGG + Intergenic
1134250836 16:12572641-12572663 CAGCTCACACAGGAGCTTGGTGG - Exonic
1134420109 16:14078962-14078984 CAGATCACACAGGTAGAAAGTGG + Intronic
1134492820 16:14708365-14708387 CAGATCACACAGCTGATAAGTGG + Intergenic
1134498201 16:14747487-14747509 CAGATCACACAGCTGATAAGTGG + Intronic
1134582373 16:15381606-15381628 CAGATCACACAGCTGATAAGTGG - Intergenic
1135132356 16:19863430-19863452 AAGGTCACACAGCTGGTAAGGGG + Intronic
1135179745 16:20262350-20262372 AAGTGCACCCAGCTGGTAGGTGG - Intergenic
1135313691 16:21425656-21425678 CAGATCACACAGCTGATAAGTGG - Intronic
1135366615 16:21857936-21857958 CAGATCACACAGCTGATAAGTGG - Intronic
1135445200 16:22513222-22513244 CAGATCACACAGCTGATAAGTGG + Intronic
1135859626 16:26044049-26044071 CAAATCACACAGCTGGTAAGTGG + Intronic
1135941208 16:26823481-26823503 AAGGTCACACAGCTAGTAGGTGG + Intergenic
1136053220 16:27668276-27668298 CAATTCCCACATGTGGTGGGTGG + Intronic
1136062267 16:27734866-27734888 AAGGTCACACAGCTGGTATGTGG - Intronic
1136152830 16:28363379-28363401 CAGATCACACAGCTGATAAGTGG - Exonic
1136193921 16:28637761-28637783 CAGATCACACAGCTGATAAGTGG + Exonic
1136210253 16:28751894-28751916 CAGATCACACAGCTGATAAGTGG + Exonic
1136310354 16:29404359-29404381 CAGATCACACAGCTGATAAGTGG - Intergenic
1136323803 16:29506150-29506172 CAGATCACACAGCTGATAAGTGG - Intergenic
1136438488 16:30246131-30246153 CAGATCACACAGCTGATAAGTGG - Intronic
1137340834 16:47602660-47602682 CAGATCACACAGGTAGTAAGTGG - Intronic
1137621944 16:49882020-49882042 CAGGCCACACAGCTGGCAGGTGG + Intergenic
1137788995 16:51158655-51158677 CAGGTCACACTGCTGGTAGGAGG - Intergenic
1138121606 16:54404809-54404831 CAGTTCAGAAAGCTGGTAAGTGG + Intergenic
1138418702 16:56885913-56885935 CAGGTCACACAGCTGGCAAGTGG + Intronic
1138497093 16:57415427-57415449 CAGGTCACACAGCTGGTCAGGGG + Intronic
1138962891 16:62048673-62048695 TAAATCACACACGTGGTAGGCGG + Intergenic
1139317148 16:66082608-66082630 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139686190 16:68605502-68605524 CAGGTCTCACAGGTAGTTGGTGG + Intergenic
1139858037 16:69996746-69996768 CAGATCACACAGCTGATAAGTGG - Intergenic
1141764529 16:86049743-86049765 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142612381 17:1116357-1116379 CAGGTCACACAGTTGGCAAGAGG - Intronic
1142618541 17:1151058-1151080 AAGGTCACACAGCTGGTAAGGGG - Intronic
1143029984 17:3962580-3962602 CAGTTCACACAGGTGTGCGCTGG + Intronic
1144311024 17:14014550-14014572 CAGTTCACACAGCTAGTCAGAGG + Intergenic
1144969180 17:19096467-19096489 CAGGTCACACAGCTGGAAAGTGG + Intronic
1144978736 17:19155599-19155621 CAGGTCACACAGCTGGAAAGTGG - Intronic
1144989486 17:19222633-19222655 CAGGTCACACAGCTGGAAAGTGG + Intronic
1146313570 17:31789798-31789820 CAGTTCTCACACATGGAAGGTGG + Intergenic
1146488665 17:33263997-33264019 AAGGTCACACAGCTGGCAGGAGG - Intronic
1146637788 17:34518970-34518992 CAGGTCACACTGGGGGTTGGTGG - Intergenic
1146680631 17:34805217-34805239 CAGTCCACACAGCAGGAAGGAGG - Intergenic
1147214949 17:38893622-38893644 CAGACCACACAGCTGGTGGGCGG - Intronic
1147622964 17:41880257-41880279 CAGGTCACACAGGTAGCATGTGG + Intronic
1148159223 17:45440706-45440728 GAGGTCACACAGCTAGTAGGTGG + Intronic
1148190252 17:45673356-45673378 CCGTTCTCATAGGTGTTAGGTGG + Intergenic
1148209137 17:45797705-45797727 AAGGTCACACAGGTAGGAGGGGG + Intronic
1148228812 17:45918406-45918428 AAGGTCACACAGCTAGTAGGGGG - Intronic
1148983462 17:51599602-51599624 CAGGACACACTGGTGGAAGGGGG - Intergenic
1149494283 17:57107164-57107186 CAGATCATTCAGGAGGTAGGAGG + Exonic
1151201474 17:72470894-72470916 AAGGTCACACAGCTAGTAGGGGG + Intergenic
1151698515 17:75730515-75730537 CAGGTCCCACGGGTGGGAGGTGG + Intronic
1152192037 17:78894251-78894273 CAGATCACACAGCTGGTAAGTGG + Intronic
1152650253 17:81489261-81489283 CAGGGCAGACAGGTGGTATGAGG - Intergenic
1154119484 18:11640018-11640040 CAGATCACACAGCTGATAAGTGG - Intergenic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1155247740 18:23925955-23925977 AAGGTCACACAGCTGGTAAGTGG - Intronic
1155536689 18:26825893-26825915 AAGTTCCCACAGCTGGTAAGTGG + Intergenic
1155652145 18:28155206-28155228 AAGGTCACACAGGTAGTAGATGG - Intronic
1156635096 18:39018345-39018367 CAGTTCACACAGGAAGAAGTTGG + Intergenic
1156813958 18:41286309-41286331 CAGTTCCCACATGTCATAGGAGG - Intergenic
1156839341 18:41592986-41593008 AAGATCACACAGGCAGTAGGTGG + Intergenic
1156972011 18:43167842-43167864 AAGTTCAAACAAGTGGTAGAAGG + Intergenic
1157123549 18:44934492-44934514 CAGTTCTCATAGGTAGTAAGAGG + Intronic
1157181393 18:45501374-45501396 CAGTCCACAAAGCTGGTAAGTGG - Intronic
1157301044 18:46479516-46479538 AAGGTCACACAGATGGTAGGTGG - Intronic
1157483584 18:48071831-48071853 AAGTTCACGCATGTGGTAGCAGG - Intronic
1157520737 18:48343591-48343613 AAGGTCACACAGCTGATAGGTGG - Intronic
1158061374 18:53347923-53347945 CAATTCTCACATGTTGTAGGAGG - Intronic
1158072163 18:53484972-53484994 TGGTTCCCACAGGTGGGAGGGGG + Intronic
1159876127 18:73813150-73813172 AAGTTCACACAGCTAGTAAGTGG - Intergenic
1162001670 19:7748129-7748151 AAGGTCACACAGCTGGTAGATGG + Intergenic
1162997036 19:14342741-14342763 CAGATCACACCGCTGGTAAGAGG + Intergenic
1163170195 19:15525733-15525755 AAGGTCACACAGGTGGGAGGAGG + Intronic
1163637868 19:18445729-18445751 CAGTTCCGAAAGGTGGCAGGTGG + Intronic
1163708319 19:18830717-18830739 AATTTCACACAGCTGGTAAGTGG + Intergenic
1163774717 19:19211496-19211518 TTGTTCACACAGCTGGTAAGAGG - Intergenic
1164598571 19:29546398-29546420 AAGGTCACACAGTGGGTAGGTGG - Intronic
1164679115 19:30122157-30122179 CACTTCACACAGATGGAGGGAGG + Intergenic
1166019023 19:40008140-40008162 AAGGTCACACAGCTGGTAGGTGG + Intronic
1166545724 19:43634076-43634098 CAGGTCACACAGATGGCAAGTGG - Intronic
1166772223 19:45290783-45290805 CAGTCCTCACAGGTGGTGGCAGG - Intronic
1166891813 19:45998692-45998714 CAGATCACACAGATGGTAACAGG + Intronic
1166992261 19:46699605-46699627 CAGTTCACACAGGCGCTGGAGGG - Intronic
1167113741 19:47476732-47476754 CAGGTCACACAGGTTGATGGGGG + Intronic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1167565316 19:50252419-50252441 GAGGTCACAGAGGTGGCAGGGGG + Intronic
1168070029 19:53944086-53944108 AAGATCACACAGGTGGAAGTTGG + Intergenic
925530775 2:4859837-4859859 CAGTTCACACAGATGATAAGTGG + Intergenic
925870717 2:8267557-8267579 AAGTTCACATAGCTGGTAAGTGG - Intergenic
926430002 2:12775999-12776021 CTAATCACACAGGTAGTAGGTGG - Intergenic
926874466 2:17459248-17459270 CAGTTCACAGCGGTGGGAAGAGG + Intergenic
927074674 2:19565871-19565893 CAGTTCCCACAGGTCATGGGAGG + Intergenic
927136993 2:20104492-20104514 CAGGTCACACACCTGCTAGGTGG - Intergenic
927228175 2:20791267-20791289 AAGCTCACACAGTTGGTAAGTGG - Intronic
927649853 2:24905849-24905871 CAGATCTCACAGTTGGTAAGTGG + Intronic
927852971 2:26511281-26511303 GAGTGCACACGGGTGGTTGGGGG + Intronic
928403158 2:30993787-30993809 GAGGTCACACAGGTGGGAAGGGG + Intronic
928450233 2:31371980-31372002 CAGGCCACACAGTTGGTAAGTGG - Intronic
928889528 2:36187276-36187298 CAAATCACACAAGTGGTATGTGG + Intergenic
929129819 2:38556061-38556083 CAGTTAACACGTGTGGTAAGGGG - Intergenic
929298043 2:40270779-40270801 CACTTACCACAGGTGGTAAGAGG + Intronic
929654596 2:43717720-43717742 AAGGTCACACAGGTGGTAAGTGG - Intronic
929667608 2:43845363-43845385 AAGGTCACACAGCTGGTAAGTGG - Intronic
929762470 2:44817334-44817356 CAGTTCACTCAGGAGGTTGAGGG + Intergenic
929966128 2:46538367-46538389 CAGATCACACAGCTGGTAAGTGG - Intronic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
931476512 2:62593076-62593098 AAGTTCACACGGATGGTAAGTGG + Intergenic
931707026 2:64955097-64955119 CAGATCACACAGCTGGAAAGTGG - Intergenic
931802647 2:65773552-65773574 CAGTACACACAGGGGCGAGGTGG + Intergenic
931983987 2:67723837-67723859 CAGATCACACAGGTAGGAAGTGG + Intergenic
932155228 2:69410484-69410506 AAGGTCACACAGGTAGTAAGTGG - Intronic
934555052 2:95282629-95282651 AAGCTCACGCAGGTGGGAGGTGG + Intronic
934684780 2:96313006-96313028 AAGATCACACAGGTAGTAAGGGG - Intergenic
934721167 2:96577904-96577926 CAAATCACACAGCTGGTAAGTGG - Intergenic
935120820 2:100182158-100182180 AAGTTCACACAGTTGGTGGGTGG + Intergenic
935246588 2:101224198-101224220 CAGTTCACGCAGCTGGTAACTGG + Intronic
936699343 2:114991948-114991970 CATTTCACATAGGTGTTGGGTGG - Intronic
938025621 2:127945448-127945470 CAGTTACTACAGCTGGTAGGTGG - Exonic
940151809 2:150610573-150610595 CAATTCACACACCTCGTAGGGGG + Intergenic
942235740 2:173903352-173903374 AAGGTCACATAGGTGGTAAGCGG + Intergenic
942386136 2:175445110-175445132 AAGGTCACACAGCTGGTAAGTGG - Intergenic
944654977 2:201868362-201868384 CCGGTCACACAGCTGGTAAGAGG + Intronic
945219977 2:207473589-207473611 CATTTAACACATGGGGTAGGGGG + Intergenic
945964528 2:216172029-216172051 GAGTGCACACAGGTGGTGGGAGG + Intronic
946536321 2:220633389-220633411 CGATTCACTCAGATGGTAGGTGG + Intergenic
946822048 2:223640516-223640538 CAATTCACACATGTTGTGGGAGG - Intergenic
946994764 2:225378931-225378953 CAGCTCACACAGTTAGTAAGTGG + Intergenic
947831980 2:233147922-233147944 CAGGTCACACAGCTGCTAAGTGG - Intronic
948337420 2:237221448-237221470 CAGGTCACACAGCTGGTAGCGGG + Intergenic
948540882 2:238690720-238690742 CAGTTCCCACAGGCGGTGGTCGG - Intergenic
948637934 2:239352104-239352126 GAGGTCACAGAGCTGGTAGGTGG - Intronic
1169131510 20:3168328-3168350 CGTTTCCCACAGGTGGGAGGGGG + Intronic
1171070189 20:22061144-22061166 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1171976252 20:31596461-31596483 CAGATCACAAAGCTGGGAGGTGG - Intergenic
1172038045 20:32024090-32024112 AAGGTCACACAGCTGGTAAGTGG + Intronic
1172161535 20:32872233-32872255 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172162165 20:32876203-32876225 CAGCTCACACAGGTCTTAGGAGG - Intronic
1172293230 20:33790877-33790899 CAGATCACACAGGTGCTGGTGGG + Intronic
1172899418 20:38323585-38323607 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172980783 20:38939965-38939987 AGGGTCACACAGCTGGTAGGTGG + Intronic
1173610345 20:44362801-44362823 AAGGTCACACAGCTAGTAGGTGG - Intronic
1173736339 20:45364095-45364117 CAGGTCACACAGCTAGTAAGTGG - Intronic
1173738187 20:45376517-45376539 CAAATCACACAGGTGGTAAGAGG - Intronic
1174037646 20:47678068-47678090 CAAGTCAGACAGGTGGGAGGTGG - Intronic
1174358957 20:50016007-50016029 CAGTTCACACAGGGTTTAAGGGG + Intergenic
1174375107 20:50121382-50121404 AAGGTCACACAGCTGGTAGGTGG - Intronic
1174389313 20:50208092-50208114 GAGGTCACACAGCTGGTGGGTGG + Intergenic
1174481884 20:50837174-50837196 GAGTTCACACAGGTGGGCAGTGG + Intronic
1174545967 20:51325425-51325447 AAGTTCACACATGTGGTTGTTGG + Intergenic
1175194350 20:57232151-57232173 AAGGTCACACAGCTGGTAAGTGG - Intronic
1175615417 20:60394079-60394101 CAGTTCACACAGGGAGCAGTAGG + Intergenic
1175681710 20:60994152-60994174 AAGGGCACACAGGTGGTAAGTGG - Intergenic
1176253362 20:64137772-64137794 CAGGTCACAGAGGTGGAAAGTGG + Intergenic
1178347117 21:31839647-31839669 AAGATCACTCAGCTGGTAGGTGG - Intergenic
1178459358 21:32788255-32788277 CAATTCCCACAGGTTGTGGGAGG - Intergenic
1178768020 21:35473150-35473172 CTGTTCACACGGGTAGTTGGGGG - Intronic
1178811100 21:35882209-35882231 CAGGTCACCCAGCTGGTAAGGGG - Intronic
1179424905 21:41268253-41268275 CAGATCACACAGCTTGTATGTGG + Intronic
1179924645 21:44527822-44527844 CAGCTCACACACGTGCTGGGCGG + Intronic
1180151396 21:45950105-45950127 GAATTCCCACAGGTGGGAGGTGG + Intergenic
1180815516 22:18787081-18787103 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1181201706 22:21221416-21221438 GAGGTCACACAGCTGGGAGGTGG - Intronic
1181674543 22:24443059-24443081 CAGGTCACACAGCTAGTAAGTGG + Intergenic
1181700051 22:24615555-24615577 GAGGTCACACAGCTGGGAGGTGG + Intronic
1181873203 22:25919354-25919376 CAGATCACACAGCTAGTAAGTGG - Intronic
1182086166 22:27562735-27562757 CAGGTCACACAGCTGATACGTGG + Intergenic
1182534192 22:30987921-30987943 CAGTTAGCAAATGTGGTAGGAGG - Intergenic
1182671326 22:31998285-31998307 CAGTTAACACAGCTAGTAAGAGG - Intergenic
1182764099 22:32746123-32746145 CAGTTCACAGAGTTGCTATGAGG + Intronic
1183293655 22:37017887-37017909 CTGCTCACACAGATGCTAGGTGG + Intronic
1183806075 22:40212262-40212284 AAGGTCACAGATGTGGTAGGTGG - Intronic
1183931594 22:41238697-41238719 CAGCTCACGCAGGTGGTTGGAGG + Exonic
1184122270 22:42459760-42459782 CAGATCAGACAGGAGGGAGGAGG + Intergenic
1184904131 22:47468232-47468254 CAGTTCCCACATGTTGTGGGAGG - Intronic
1185319551 22:50194141-50194163 CAGCTCACAGAGGTGGTAGCCGG + Intronic
1203225208 22_KI270731v1_random:74012-74034 GAGGTCACACAGCTGGGAGGTGG + Intergenic
1203265619 22_KI270734v1_random:12772-12794 GAGGTCACACAGCTGGGAGGTGG - Intergenic
950143729 3:10633126-10633148 AAGGTCACACAGCTGGGAGGTGG - Intronic
950427564 3:12932726-12932748 CAGGTCCCACAGCTGATAGGTGG + Intronic
950502495 3:13373221-13373243 CACTTCACAATGGTGGCAGGTGG - Intronic
951085274 3:18505468-18505490 GATATCACACAGCTGGTAGGTGG - Intergenic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
951805937 3:26643506-26643528 AAGATCACACAGCTGGTGGGTGG - Intronic
953861741 3:46550168-46550190 AAGTTCACACAGATGGTAAGTGG - Intronic
955106954 3:55907697-55907719 AAGGTCACACAGCTGGTAAGTGG - Intronic
955350474 3:58189730-58189752 GAGGTCCCACAGCTGGTAGGTGG + Intergenic
955803611 3:62710725-62710747 AAGTTCACAAATGTGGTGGGAGG - Intronic
956463370 3:69494541-69494563 GAGTTCACACATGTGGGAAGAGG + Intronic
956703198 3:71976960-71976982 TAGGTCACACAGCTGGTAGCAGG - Intergenic
956730782 3:72194719-72194741 TAGATCACACAGCTGGTAGCAGG - Intergenic
956798061 3:72733685-72733707 AAGGTCACAGAGCTGGTAGGCGG + Intergenic
957598090 3:82294161-82294183 CAGTTCACAAAGGTGCTATTTGG + Intergenic
958648020 3:96898449-96898471 CAGGTCAGACAAGTGGTAGCTGG - Intronic
959095599 3:101952180-101952202 AAGATCTCACAGCTGGTAGGTGG + Intergenic
959606981 3:108251554-108251576 AAGGTCACACAGCTGGTATGTGG + Intergenic
960618875 3:119620504-119620526 CTGATCACACAGCTGGTAAGTGG - Intronic
962631389 3:137279731-137279753 AAGGTCACACAGGTGGCAAGTGG + Intergenic
964159607 3:153630999-153631021 AAGGTCACACAGCTGGTAAGTGG - Intergenic
964384159 3:156129549-156129571 CAGGTCACACAGATTGTAAGGGG - Intronic
964830198 3:160875753-160875775 CAGGTCACATAGCTGGTAGCTGG + Intronic
965727988 3:171739779-171739801 AAGGTCACACAGCTGGTAAGTGG + Intronic
966325078 3:178744968-178744990 CCTGTCACACAGGTAGTAGGTGG - Intronic
968279612 3:197466393-197466415 AAGCTCACACAGCTGGTAAGAGG - Intergenic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
969671455 4:8592530-8592552 CAGTGCACTCAGGTGGCAGATGG + Intronic
969943719 4:10761431-10761453 CAGTTCCCACATGTTGTGGGAGG - Intergenic
970218874 4:13786752-13786774 GACTACACAGAGGTGGTAGGAGG + Intergenic
970508968 4:16761531-16761553 AAGTTCACAAAGCTGGGAGGGGG - Intronic
971155181 4:24074213-24074235 AAGCTCACACAGGTAGTAGGAGG - Intergenic
972792597 4:42387381-42387403 CAATTCGCACATGTTGTAGGAGG - Intergenic
974053008 4:56958852-56958874 CAGATCACAGAGGTGGTTAGGGG - Intergenic
974991009 4:69090643-69090665 CAATTCCCACATGTTGTAGGAGG - Intronic
975496836 4:75044985-75045007 CAGTTCCCACATGTTGTGGGAGG - Intronic
976086552 4:81412752-81412774 AAGTTCACAAAGCTGGTAAGCGG - Intergenic
976318893 4:83688664-83688686 CATGTCACACAGGTAGTAAGTGG + Intergenic
977278527 4:95009786-95009808 CAGTTCACACAGTTACTAGATGG - Intronic
977761272 4:100739781-100739803 AAGGTCACACAGGTTGTAGGTGG - Intronic
978646199 4:110934712-110934734 CAAGTCACACAGCTGGTATGTGG + Intergenic
979695691 4:123610688-123610710 AAGGTCACACAGGTAGTAAGTGG + Intergenic
981073197 4:140566954-140566976 AAGGTCACACAGCTGGGAGGGGG - Intronic
981582733 4:146266799-146266821 AAGGTCACACAGGTGGTAAATGG - Intronic
982246066 4:153352505-153352527 CAGTTCACAGTGTTGGTATGGGG + Intronic
983433633 4:167683201-167683223 CAGTTCCCACATGTGGCGGGAGG - Intergenic
983660310 4:170125087-170125109 CAGTTCACACATGTCATAGGAGG + Intergenic
984214486 4:176892436-176892458 TAGTTCACATAGCTGGTAAGAGG + Intergenic
986218219 5:5741397-5741419 GAATTCACACAAATGGTAGGTGG + Intergenic
987123623 5:14791182-14791204 AAGATAACACAGCTGGTAGGGGG - Intronic
987135522 5:14896371-14896393 AAGGTCACACAGCTGGTAAGAGG - Intergenic
987651100 5:20740905-20740927 CAGTTCCCACATGTTGTGGGAGG - Intergenic
987785792 5:22496979-22497001 AAGATCACACAGCTGGTAAGTGG - Intronic
988144454 5:27287549-27287571 CAATTCCCACATGTTGTAGGAGG - Intergenic
988392508 5:30653898-30653920 AAATTCACACAGATTGTAGGTGG - Intergenic
989197124 5:38726483-38726505 CAGGTCACACATCTGGCAGGTGG - Intergenic
989251862 5:39326229-39326251 AAATTCACATAGGTGGTAAGTGG + Intronic
990329448 5:54711730-54711752 CAGTTCCCACATGTTGTGGGAGG + Intergenic
990376976 5:55180454-55180476 AAGTTCACACAGCTAGTAGATGG - Intergenic
990672607 5:58149919-58149941 CAGTTCACACAGATTCCAGGAGG - Intergenic
990922761 5:60985834-60985856 CAATTCCCACATGTGGTGGGAGG - Intronic
991127719 5:63086413-63086435 CAGGTCACACAGCTAGTAGGTGG - Intergenic
991617664 5:68513837-68513859 AAGGTCACACAGCTGGTAAGTGG - Intergenic
992027945 5:72689788-72689810 GAAATCACACAGTTGGTAGGTGG + Intergenic
992361436 5:76042285-76042307 CAGTTCACAAAGCTAGTAAGTGG - Intergenic
995174960 5:109165565-109165587 CACACCACACAGGTGGGAGGAGG + Intronic
995336309 5:111003786-111003808 AAGTTCACACAGCTGGTATGAGG + Intergenic
996975380 5:129427072-129427094 CAGTTTACACAGGTGGGAAGTGG + Intergenic
998388187 5:141770409-141770431 CAAGTCACACAGCTGGTAAGTGG - Intergenic
998414471 5:141936260-141936282 GAGTTAACACAGCTGGTAAGTGG + Intronic
998783233 5:145681487-145681509 AAGATCACACAGGTAGTAAGTGG - Intronic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999255462 5:150207676-150207698 AAGGTCACACAGGTGGGAAGTGG - Intronic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
999710195 5:154311482-154311504 CAGTTCACACTGCTAGTAGAAGG + Intronic
999809328 5:155113004-155113026 CAGGTCACACAGCTAGTAAGTGG - Intergenic
1000161657 5:158603412-158603434 GAGTTCACATAGCTGGTAAGTGG - Intergenic
1000221659 5:159220209-159220231 AAGGTCACACAGCTGGTAAGAGG - Intergenic
1000537500 5:162497058-162497080 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1000946980 5:167435274-167435296 CAATTCCCACATGTTGTAGGAGG + Intronic
1001141396 5:169146864-169146886 AAGTTCACACAGCTAGTAAGTGG - Intronic
1001277022 5:170358515-170358537 AACTTCACACAGCTGGTAAGAGG - Intronic
1001299932 5:170526133-170526155 CAGGTCACACAAGTGCAAGGTGG - Intronic
1001309528 5:170600989-170601011 AAGGTCACACAGCTGGTAAGTGG - Intronic
1001528751 5:172447620-172447642 GAGGTCACACAGTTGGTAGGTGG + Intronic
1001555839 5:172636711-172636733 CAGGTCACACAGCTAGAAGGGGG - Intergenic
1001570791 5:172729359-172729381 CACTTCATACAGTTGTTAGGAGG - Intergenic
1001685881 5:173594772-173594794 AAGAACACACAGCTGGTAGGGGG + Intergenic
1003013906 6:2452410-2452432 CAGCTGACACAGATGGTGGGAGG + Intergenic
1003046280 6:2735982-2736004 GAGGTCACACAGCCGGTAGGTGG + Intronic
1003841581 6:10126058-10126080 CAGTTCATTTAGGTGGGAGGAGG - Intronic
1004282413 6:14292315-14292337 CTATTTACACAGGTGGTAGCAGG - Intergenic
1004815357 6:19306493-19306515 CACTTCACATATGTGGTAGAAGG + Intergenic
1005269353 6:24146840-24146862 AAGATCACACAGGTAGTAGAAGG - Exonic
1006461591 6:34162284-34162306 GAGCTCAGACAGGTGGCAGGGGG + Intergenic
1006593515 6:35175895-35175917 TAGGTCACACAGCTGGTAAGGGG - Intergenic
1006906724 6:37537922-37537944 CAGCTCACACGGCTGGTAAGAGG - Intergenic
1007252982 6:40509017-40509039 CAGACCTCACAGGTGGAAGGAGG - Intronic
1007930302 6:45684985-45685007 AAGACCACACAGTTGGTAGGTGG + Intergenic
1007947452 6:45839054-45839076 AAGTTCTCACAGCTGGTAAGGGG + Intergenic
1008466844 6:51841264-51841286 TAATTCACACAGGTCATAGGTGG - Intronic
1008680527 6:53867091-53867113 AAGTTTACACAGCTGGTAAGTGG - Intronic
1008746671 6:54678800-54678822 AAGGTCACACAGGTAGTAGGTGG - Intergenic
1010446116 6:75950554-75950576 CAATTCACACAGCTGGTGAGTGG - Exonic
1011433676 6:87315169-87315191 CACTTCACACAAGGGGTCGGCGG - Intronic
1012313993 6:97762395-97762417 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1015130603 6:129804241-129804263 CAATTCCCACATGTTGTAGGAGG + Intergenic
1015571244 6:134623506-134623528 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1015816160 6:137212853-137212875 CAAGACAGACAGGTGGTAGGAGG + Intronic
1016707289 6:147124462-147124484 CAGTTCTCACAGGTTTTTGGTGG - Intergenic
1017529835 6:155278664-155278686 AAGTTCACACAGCTAGTAAGTGG + Intronic
1017580580 6:155860072-155860094 CAGTTCCCACATGTTGTGGGAGG + Intergenic
1019332887 7:469603-469625 CAGTACACACATGTGGCCGGTGG + Intergenic
1020837108 7:13167744-13167766 CAATTCCCACATGTTGTAGGAGG - Intergenic
1021170531 7:17393759-17393781 CAATTCCCACACGTTGTAGGAGG - Intergenic
1021434190 7:20595582-20595604 AAGTTCACGAAGGTAGTAGGTGG + Intergenic
1021762566 7:23915522-23915544 CAGTTCACTCCTGTGGAAGGGGG + Intergenic
1022394200 7:29971176-29971198 CAGGTCACACAGCTAGTAGGTGG - Intronic
1022441707 7:30438327-30438349 AAGTTCACACAGGTAGCAGATGG - Intronic
1022487464 7:30790839-30790861 CAGGTGACACAGTTGGTAGGTGG + Intronic
1022805474 7:33816984-33817006 CAAGTCACACAGATGGAAGGTGG + Intergenic
1023856067 7:44185190-44185212 AAGTTCACACAGCTGTGAGGGGG + Intronic
1026434068 7:70378593-70378615 AAGTTCACACAGCTAGTATGTGG + Intronic
1026606611 7:71821585-71821607 TAGTTCCCACATGTTGTAGGAGG - Intronic
1027188478 7:75985137-75985159 CAGCTCACACAGGTGGTCGATGG - Exonic
1028296506 7:89138670-89138692 CAGTTCCCACATGTTGTGGGAGG + Intronic
1028814503 7:95129217-95129239 CAGTTCCCACATGTTGTGGGAGG + Intronic
1029084458 7:98000466-98000488 CAATTCACACACGTGGCACGTGG + Intergenic
1029600908 7:101562993-101563015 AAGGTCACACAGGCGGTTGGCGG + Intergenic
1029672158 7:102040786-102040808 AAGGTCACAGAGGTGGTGGGCGG - Intronic
1031627407 7:124006248-124006270 CAGTCCACCCATGTAGTAGGGGG + Intergenic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1032190072 7:129759935-129759957 AAGTTCACACTGCTGGTAAGAGG + Intergenic
1032451935 7:132039122-132039144 CAGGTCACACAGCTAGTAGGTGG + Intergenic
1033310714 7:140259980-140260002 CAGTTCTCACAGCAGGTAGGAGG + Intergenic
1034944371 7:155252460-155252482 CTGTTCACACAGTGGGAAGGAGG + Intergenic
1035244041 7:157550794-157550816 CAGCTCACGCGGGTGGAAGGCGG + Intronic
1035595188 8:852059-852081 CAATTCTCACAGCTGGCAGGAGG - Intergenic
1036429932 8:8680806-8680828 CAGTTCACCCAAATGGGAGGAGG + Intergenic
1037436017 8:18864262-18864284 AAGGTCACACAGATGGTAAGTGG - Intronic
1037610142 8:20469156-20469178 GAGGTCACACAACTGGTAGGTGG - Intergenic
1037645772 8:20791494-20791516 AAGGTCACACAGCTGGTAGTTGG - Intergenic
1037725313 8:21478508-21478530 CAGATCTCACAGCTGGTAAGTGG + Intergenic
1038861959 8:31397421-31397443 AAGTTCACCCAGGTGGTTGATGG + Intergenic
1039379102 8:37068147-37068169 CATTTCATATGGGTGGTAGGAGG - Intergenic
1039905686 8:41784925-41784947 CAGGTCACACATGTGGTCAGTGG + Intronic
1041122360 8:54600095-54600117 CAATTCCCACATGTTGTAGGAGG + Intergenic
1041772551 8:61487405-61487427 CAGATCACAGAGCTAGTAGGTGG + Intronic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1044430296 8:92101194-92101216 CAGTTCACACAGAAGGTATAAGG + Intronic
1044835383 8:96290366-96290388 CAGTTCTCACAGCCAGTAGGAGG + Intronic
1044865416 8:96565985-96566007 AAGATCACACAGCTGGTACGTGG - Intronic
1044950355 8:97429994-97430016 AAGGTCACACAGCTGGTTGGTGG - Intergenic
1046219917 8:111200812-111200834 CCGTTCACTCACGTGGAAGGGGG + Intergenic
1047010441 8:120667289-120667311 CAGCTCACACAGGTGAAAGCTGG + Intronic
1047307499 8:123664789-123664811 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1047314193 8:123717174-123717196 AAGTTCACACAGCTGCTAAGAGG - Intronic
1047757728 8:127931596-127931618 CAGATCACACAGCTGGAAAGTGG + Intergenic
1048297469 8:133225083-133225105 AAGATCACACAGCTTGTAGGTGG + Intronic
1048957484 8:139548968-139548990 GAGGTCACAAAGGTGGTGGGGGG - Intergenic
1050341069 9:4638988-4639010 CAGATCACATAGTTGGTAAGTGG - Intronic
1051450546 9:17193117-17193139 TAATTCCCACAGGTTGTAGGAGG - Intronic
1051707149 9:19892795-19892817 AAGGTCACACAGATGGTAAGTGG + Intergenic
1051716851 9:19994044-19994066 AAGTTCACATAGCTGGCAGGTGG + Intergenic
1051746854 9:20303275-20303297 CAATTCACTCAGGTGGGAGGAGG - Intergenic
1052170973 9:25396121-25396143 CAGGACACAGAGGTGGTAAGTGG - Intergenic
1052431853 9:28376556-28376578 CAGTTCCCTCGGGTGGAAGGTGG - Intronic
1053299864 9:36941402-36941424 CAAATCACACAGCTGGTAAGAGG - Intronic
1056192628 9:84199165-84199187 CAGGGCACACTGGTGGAAGGGGG + Intergenic
1056193794 9:84209818-84209840 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1056316633 9:85396646-85396668 AAGCTCACACAGGTGCTAAGTGG + Intergenic
1057239694 9:93398111-93398133 CAGTTCCCACATGTAGTGGGAGG + Intergenic
1057896936 9:98916718-98916740 CAGATCAGAGAGGTGGGAGGGGG + Intergenic
1059404951 9:114093737-114093759 CAGGTGACACAGCTAGTAGGTGG + Intronic
1059761889 9:117345530-117345552 AAGGTCACACAGCTGATAGGTGG + Intronic
1059765775 9:117382505-117382527 AAATGCACAGAGGTGGTAGGTGG + Intronic
1060400330 9:123344858-123344880 AAGGTCACACAGCTGGTAGAAGG - Intergenic
1060578176 9:124717775-124717797 AAGGTCACACAGCTGGTAAGTGG - Intronic
1060591774 9:124821373-124821395 TAGGTTCCACAGGTGGTAGGTGG - Intergenic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1060741912 9:126104355-126104377 TAGGTCACACAGCTGGTAAGTGG - Intergenic
1060977907 9:127776273-127776295 GAGCTCACACCGCTGGTAGGTGG + Intronic
1061025132 9:128043531-128043553 CAGTTTGCACTGGTGGTAGCTGG + Intergenic
1061857113 9:133448458-133448480 GAGGTCACACAGCTGGTAAGTGG + Intronic
1186517848 X:10179901-10179923 AAGGTCACACGGGTGGTAAGTGG + Intronic
1186684881 X:11915786-11915808 GAGTTCACACAGCTGGTTAGTGG - Intergenic
1186780761 X:12909766-12909788 AAGGTCACTCAGATGGTAGGTGG - Intronic
1187031445 X:15492620-15492642 CAGGTCACACAGCTGATATGTGG - Intronic
1187227870 X:17391304-17391326 AAGGTCACACAGCTGGTAAGTGG - Intronic
1187402632 X:18975198-18975220 CAATTCCCACATGTTGTAGGAGG + Intronic
1188440684 X:30213072-30213094 GAGTTCACATAGCTGGTAAGTGG + Intergenic
1188725163 X:33573937-33573959 CAGTGCACACATGTGGTGGTGGG + Intergenic
1189346674 X:40247212-40247234 AAGGTCACACAGGTAGTAAGTGG + Intergenic
1190338289 X:49276405-49276427 CAGGTCACACAGCTGATAGGTGG + Intronic
1192231534 X:69268604-69268626 CAGTTCACAAAGCTAGTAAGTGG - Intergenic
1192591358 X:72362484-72362506 AAGGTCACACAGCTAGTAGGTGG - Intronic
1192681076 X:73254594-73254616 CAGTTTACACAGGGAGAAGGAGG + Intergenic
1193630155 X:83875660-83875682 CAATTCACACATGTCGTGGGAGG - Intronic
1194810074 X:98378643-98378665 CAGTTCAAACAAGTGGTGGAAGG - Intergenic
1194861868 X:99009460-99009482 CAGGTCACACAGGTAGTAATGGG - Intergenic
1195598572 X:106720722-106720744 AAGGTCACACAGCTGGTAGGTGG - Intronic
1195849800 X:109270972-109270994 CTGCCCACACAGGAGGTAGGTGG + Intergenic
1196187390 X:112759076-112759098 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1196934358 X:120714884-120714906 AAGATCACACAGGTGGTAAGTGG - Intergenic
1196938631 X:120753945-120753967 CAGCCCACACAGGTGCGAGGTGG - Intergenic
1197829697 X:130628277-130628299 AAGGTCACACAGCTGGTAAGTGG + Intronic
1198398629 X:136248835-136248857 CAGTTCACACAGGTAGTAAGTGG + Intronic
1198524981 X:137491990-137492012 AAGTTCACACAGCTAGTATGTGG + Intergenic
1198651326 X:138866585-138866607 AAGGTCACACTGGTGGTAAGTGG - Intronic
1198996221 X:142577233-142577255 CAATTCCCACATGTGGTGGGAGG + Intergenic
1199182640 X:144876643-144876665 TAATTCCCACATGTGGTAGGAGG - Intergenic
1199551587 X:149067233-149067255 AAGTTCACACAGCTAGTAGGTGG + Intergenic
1199565333 X:149209757-149209779 CTGTTAACACAGGTGGACGGTGG + Intergenic
1199792748 X:151170266-151170288 CAGGTCACACAGGTAATAAGTGG - Intergenic
1201482868 Y:14459217-14459239 CAGTCCACACAGGTGAAAGGTGG - Intergenic
1201906726 Y:19093061-19093083 CAATTCCCACATGTTGTAGGAGG + Intergenic