ID: 908124138

View in Genome Browser
Species Human (GRCh38)
Location 1:61013471-61013493
Sequence CCAAAGTGACCCTGGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 204}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908124134_908124138 4 Left 908124134 1:61013444-61013466 CCACATCTGAGTTTGCAAATAGG No data
Right 908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 204
908124132_908124138 9 Left 908124132 1:61013439-61013461 CCCATCCACATCTGAGTTTGCAA No data
Right 908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 204
908124131_908124138 12 Left 908124131 1:61013436-61013458 CCACCCATCCACATCTGAGTTTG No data
Right 908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 204
908124128_908124138 30 Left 908124128 1:61013418-61013440 CCTAATGCATAATCTTCCCCACC 0: 1
1: 0
2: 0
3: 33
4: 236
Right 908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 204
908124133_908124138 8 Left 908124133 1:61013440-61013462 CCATCCACATCTGAGTTTGCAAA 0: 1
1: 0
2: 1
3: 35
4: 397
Right 908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 204
908124129_908124138 14 Left 908124129 1:61013434-61013456 CCCCACCCATCCACATCTGAGTT 0: 1
1: 0
2: 3
3: 54
4: 376
Right 908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 204
908124130_908124138 13 Left 908124130 1:61013435-61013457 CCCACCCATCCACATCTGAGTTT No data
Right 908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG 0: 1
1: 0
2: 3
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908124138 Original CRISPR CCAAAGTGACCCTGGCTCAG AGG Intronic
901088622 1:6627061-6627083 GAAAAGTGACCCAGGCTCAGGGG - Intronic
901130802 1:6961878-6961900 CCAGAGTGCGCCTTGCTCAGAGG + Intronic
901148930 1:7087463-7087485 GGGAAGTGACCCTGGGTCAGTGG + Intronic
901216647 1:7558986-7559008 CCAAAGTGACCCTGGCCTTCAGG - Intronic
901773560 1:11543687-11543709 CCAAAGTGTCCCTGGGACAAGGG - Intergenic
902360742 1:15941455-15941477 CCAGAGCGAGCCTGGCTCACAGG - Intergenic
902368937 1:15993600-15993622 CCAGCCTGGCCCTGGCTCAGGGG + Intergenic
905621591 1:39452931-39452953 CCAGAGTGGCCCTAGCTCATTGG + Intronic
908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG + Intronic
908524465 1:64974819-64974841 CCAAAGTGGCCACGGCTCACGGG + Intergenic
908959975 1:69684996-69685018 ATAAAGAGACCCAGGCTCAGTGG + Intronic
910855372 1:91689716-91689738 TCAAAGTTACCCAGGCACAGCGG - Intronic
911856960 1:102890459-102890481 CAAAGGTGACCCTGGCTCCAAGG - Exonic
913956060 1:143294897-143294919 CCACAGTGATCCTTGGTCAGTGG - Intergenic
913981371 1:143520543-143520565 CCACAGTGATCCTTGGTCAGTGG + Intergenic
914075744 1:144347198-144347220 CCACAGTGATCCTTGGTCAGTGG + Intergenic
914103434 1:144619298-144619320 CCACAGTGATCCTTGGTCAGTGG - Intergenic
915874971 1:159602671-159602693 CCCAAGTGACTCTGCCACAGTGG - Intergenic
915939438 1:160109483-160109505 CCAAAGCAAACCTGCCTCAGGGG + Intergenic
917935050 1:179858127-179858149 CCTGAGTGACCCTGTCTCGGGGG + Intronic
918151635 1:181802108-181802130 CTATGTTGACCCTGGCTCAGGGG - Intronic
921063149 1:211603208-211603230 CCACAGTGTGCCTGGCTCAGAGG - Intergenic
1062952556 10:1515685-1515707 CCTAAGTGACTCTGGCTGAGGGG - Intronic
1063151328 10:3339298-3339320 CACAAGACACCCTGGCTCAGTGG + Intergenic
1063392400 10:5659143-5659165 CCACAGGGAGCCTGGCACAGGGG - Intronic
1063965677 10:11344281-11344303 CCAGGGTGTCCCTGGCTCACGGG - Intergenic
1064716401 10:18181149-18181171 GCAAGGTGACCCTGGGTCAATGG - Intronic
1067708351 10:48627767-48627789 CCAAAGTGACCCTCATCCAGGGG - Intronic
1069693692 10:70371647-70371669 GGAAAGAGAGCCTGGCTCAGGGG + Intronic
1069816041 10:71195127-71195149 CCACAGTGAGCCTGGGTAAGGGG - Intergenic
1069912868 10:71770564-71770586 CCAGACTGACCCTGGGTCATTGG + Intronic
1070127442 10:73633611-73633633 TCAAAGCAACCCAGGCTCAGAGG + Intronic
1072338127 10:94418722-94418744 CAAAAGTTAGCCTGGCACAGTGG - Intronic
1072664341 10:97383047-97383069 TCAAAGTGGGCCTGGCACAGTGG - Intronic
1074183418 10:111082194-111082216 CTCCAGTGACCCTGGCTCAGAGG + Intergenic
1074185037 10:111093734-111093756 CCCAAGTGACCCTGACTTTGAGG - Intergenic
1075429873 10:122371333-122371355 CAAAAGTGACCATTGCTAAGGGG + Intergenic
1076594705 10:131618533-131618555 CCAAGGTGACCCTGGCACGTGGG + Intergenic
1077295571 11:1824923-1824945 CCAAAGAGACCCCAGTTCAGAGG + Intergenic
1079194705 11:18315326-18315348 CCAAAGTGGGCCAGGCTCAATGG + Intronic
1080873518 11:36257495-36257517 CTAGAGTCTCCCTGGCTCAGTGG + Intergenic
1081676498 11:44973000-44973022 CCAGATTGAGGCTGGCTCAGTGG + Intergenic
1081712700 11:45227525-45227547 CCCAGGTCATCCTGGCTCAGAGG + Intronic
1081717138 11:45258385-45258407 CCAAAGTGACCCAGCTCCAGCGG - Intronic
1081743534 11:45457415-45457437 CCAAGTGGACTCTGGCTCAGAGG + Intergenic
1082049369 11:47758235-47758257 CCAAAGTTAGCCAGGCGCAGTGG - Intronic
1082916372 11:58442572-58442594 TCAAAGTGACTCTGGTTCTGGGG + Intergenic
1084415736 11:69032068-69032090 CTCAAGTGCCCCTGGCTGAGAGG + Intergenic
1084553318 11:69862038-69862060 CCAATGTGACCAGTGCTCAGGGG - Intergenic
1088244065 11:107799844-107799866 CCAAAGTGTGCCGGGCACAGGGG - Intronic
1091076584 11:132623714-132623736 CCAAATTGACCCTGTGCCAGGGG - Intronic
1093290603 12:17316595-17316617 GCAAAGTGAGCCAAGCTCAGTGG + Intergenic
1094025161 12:25954359-25954381 CCAAAGCTATCCTGGTTCAGGGG - Intergenic
1095986370 12:48002227-48002249 CGAAAGTGCCCCTGGCTCAGGGG - Intronic
1096880619 12:54666063-54666085 CCAAGGTGAAACTGGCCCAGGGG + Intergenic
1098244940 12:68507262-68507284 CCAAAGTTACCATTGTTCAGGGG - Intergenic
1103124931 12:118413557-118413579 GCTCAGTAACCCTGGCTCAGGGG + Intronic
1103341077 12:120221488-120221510 TGACAGTGTCCCTGGCTCAGGGG + Intronic
1103542994 12:121679209-121679231 CTAATCAGACCCTGGCTCAGAGG + Intergenic
1104241699 12:126996187-126996209 CCAAAGTGAACATGGCTTACGGG - Intergenic
1104493189 12:129212473-129212495 CAAAAGAGACCCTTGTTCAGTGG + Intronic
1104759721 12:131289657-131289679 CCAAGGTCACCCGGGCTCAGGGG - Intergenic
1104820994 12:131677556-131677578 CCAAGGTCACCCGGGCTCAGGGG + Intergenic
1110150222 13:72243205-72243227 CCATCCTGACCCTTGCTCAGAGG + Intergenic
1110551830 13:76819316-76819338 CAACAGTGACTTTGGCTCAGTGG - Intergenic
1113442762 13:110342061-110342083 CCCAAGTGACCCTGGCTCATTGG + Intronic
1118468753 14:66055575-66055597 CTACAGTGACCTTGGCACAGTGG + Intergenic
1118899906 14:69977935-69977957 CCTGAGTTACCCTGGCTCAAGGG - Exonic
1120240119 14:81940150-81940172 TCAAAATGAGCCTGGCACAGTGG - Intergenic
1121102215 14:91257642-91257664 CTGAAGTGACCCTGGCAGAGTGG - Intergenic
1121454049 14:94027181-94027203 CCAGGGTTAGCCTGGCTCAGAGG - Intronic
1121869899 14:97397447-97397469 CCTCAGTGACCCCAGCTCAGAGG + Intergenic
1122327247 14:100890245-100890267 CCAATGGGCCACTGGCTCAGAGG - Intergenic
1125475425 15:40044926-40044948 CCACAGGGAACCTGCCTCAGAGG + Intergenic
1125672914 15:41486481-41486503 CCACTGGGACCCTGGCTCTGAGG - Intergenic
1127850739 15:62909925-62909947 CCCAAGTGGCCTTGGTTCAGAGG + Intergenic
1130078803 15:80713205-80713227 CCAAGGAGAGCCTGGCTCTGTGG - Intronic
1131954531 15:97717987-97718009 ACAAACTGCCCCAGGCTCAGTGG - Intergenic
1133069211 16:3234798-3234820 CCAGAGTGAGCCTGGCCCGGCGG - Exonic
1133739614 16:8641239-8641261 CCTCAGTGCCCCTGGCTCTGTGG + Intronic
1135691104 16:24538908-24538930 CCAAGGAGACCCAGGCACAGAGG + Intronic
1136372185 16:29843483-29843505 CCACAGAGACCCTGTCTCGGAGG + Intronic
1136700723 16:32137883-32137905 CCACAGTGATCCTTGGTCAGCGG + Intergenic
1136766935 16:32789576-32789598 CCACAGTGATCCTTGGTCAGCGG - Intergenic
1136801160 16:33080802-33080824 CCACAGTGATCCTTGGTCAGCGG + Intergenic
1138373572 16:56546859-56546881 CACATGTGACCCGGGCTCAGTGG - Intergenic
1139734143 16:68972921-68972943 GCCAAGTGATCCTGGCTCGGAGG - Intronic
1139903093 16:70343433-70343455 CAGAAGTGGGCCTGGCTCAGTGG + Intronic
1140028131 16:71310714-71310736 CCAAAGTGACTTTGGCTAAAGGG - Intergenic
1141714196 16:85717412-85717434 CCACAGTGGCCCTAGCTCAGGGG - Intronic
1203069330 16_KI270728v1_random:1051828-1051850 CCACAGTGATCCTTGGTCAGCGG - Intergenic
1142473928 17:179077-179099 CCAAGCTGGCCCTAGCTCAGTGG + Intronic
1143911127 17:10250433-10250455 CCAAAGTGACCCTGTCACTTTGG + Intergenic
1144554834 17:16272934-16272956 TCCACGTGAACCTGGCTCAGTGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1145978374 17:28997266-28997288 CCAAAGAGCCCCTGGCAAAGGGG - Intronic
1146064049 17:29621677-29621699 CCACAGAGACCCAGGCTGAGGGG + Intronic
1146765919 17:35521570-35521592 CCCAATTGAGCCTGGCACAGTGG + Intronic
1146949046 17:36893079-36893101 CCACAGTGACCATGGAGCAGGGG + Intergenic
1147041316 17:37721532-37721554 CCAAGGTCACCCTTGCTCATTGG + Intronic
1148371396 17:47102331-47102353 CAAAAGTTAGCCTGGCGCAGTGG - Intergenic
1150217391 17:63478070-63478092 CCAACCTGCCCCTGGCTAAGCGG + Intergenic
1151885001 17:76918299-76918321 CCTCAGGGTCCCTGGCTCAGAGG - Intronic
1151906009 17:77049903-77049925 GCAAAGTCCCCCTGGCTCAGTGG - Intergenic
1151926944 17:77204702-77204724 CAACAGTGAGCCAGGCTCAGTGG - Intronic
1153837720 18:8979044-8979066 CCAAAATGAACCTGACTCTGTGG - Intergenic
1155567354 18:27150238-27150260 CCAATGTCACTCTGGCTCAGGGG - Intronic
1157296016 18:46444758-46444780 CCAAAATGAGCCAGGCACAGTGG - Intronic
1157995367 18:52548281-52548303 TGAAAGTCACCCTGACTCAGGGG + Intronic
1158693838 18:59685450-59685472 CACAAGAGACCCTGGCTTAGTGG + Intronic
1160153482 18:76412975-76412997 CCACAGTGAGCCCTGCTCAGAGG + Intronic
1160883898 19:1335923-1335945 CCAAGGTGACCCAGGGCCAGTGG - Intergenic
1161226977 19:3151254-3151276 CTAAAGTGACCCTGTTTTAGGGG + Intronic
1161377914 19:3949647-3949669 CCGCTGTGCCCCTGGCTCAGTGG + Intergenic
1162032091 19:7921903-7921925 CCTCAGTGTCCCTGGCTCTGAGG + Intronic
1163472748 19:17506820-17506842 CCAAAGGGACCTTGGGGCAGGGG + Intergenic
1165112071 19:33508266-33508288 CCAAGGGTACCCTGGCACAGGGG + Intronic
1168325335 19:55536074-55536096 CCATAGCAACCCTGGCCCAGGGG + Exonic
924995673 2:358481-358503 CCACGGTGACCCTGGAGCAGTGG + Intergenic
932318227 2:70800709-70800731 CCTAAGTGACCCAGGCTAAGGGG + Intergenic
933126045 2:78607732-78607754 TCAAACTGATCCTGGCGCAGTGG + Intergenic
933135260 2:78726371-78726393 TCAAAGTGAGCCAGGCACAGTGG + Intergenic
935027517 2:99291622-99291644 CACAGGGGACCCTGGCTCAGGGG - Intronic
936986158 2:118312854-118312876 CTAAAGTGGGCCAGGCTCAGTGG + Intergenic
938375023 2:130799282-130799304 CCAAAAGGACCCTGCCTAAGAGG + Intergenic
939126447 2:138183291-138183313 AAAAAGCTACCCTGGCTCAGAGG + Intergenic
940414923 2:153408527-153408549 CAAAAGGGACCCTGGCTCACTGG + Intergenic
944621745 2:201522855-201522877 CCAAACTGGCCCTGTCTCACAGG - Intronic
948353188 2:237357630-237357652 CCAGAGTGACCCTTGCCAAGTGG - Intronic
1169964377 20:11198418-11198440 CCACAGTGACCATGGATGAGTGG - Intergenic
1170919874 20:20667951-20667973 CCAGAGTGCCCTTGGCTGAGGGG - Intronic
1172406469 20:34693559-34693581 CCAAGGACAGCCTGGCTCAGTGG + Intergenic
1172760525 20:37318137-37318159 CCAGAGTGCACCTGGCTGAGTGG + Intergenic
1173021352 20:39270116-39270138 CAAAAGAGAGCCTGGCACAGAGG - Intergenic
1174895596 20:54446430-54446452 TCAAATTGAGCCTGGCACAGTGG + Intergenic
1175315894 20:58046466-58046488 CCAAAGTCACCCCAGCTCAGAGG + Intergenic
1175765233 20:61587673-61587695 CCAAAGGGACCCTGGCTGTAGGG + Intronic
1175808617 20:61845439-61845461 CCGAACTGACCCTGGCCGAGAGG + Intronic
1176328635 21:5525028-5525050 CGAAGGTGACCCAGGCTGAGTGG + Intergenic
1176399122 21:6295923-6295945 CGAAGGTGACCCAGGCTGAGTGG - Intergenic
1176438035 21:6693181-6693203 CGAAGGTGACCCAGGCTGAGTGG + Intergenic
1176462297 21:7020251-7020273 CGAAGGTGACCCAGGCTGAGTGG + Intergenic
1176485858 21:7402029-7402051 CGAAGGTGACCCAGGCTGAGTGG + Intergenic
1178307314 21:31501476-31501498 CCAAAGTGACCCAAGCTCGACGG + Intronic
1178500458 21:33121862-33121884 CCCAGGTGACCCTGGCCCATGGG + Intergenic
1178736984 21:35161372-35161394 TCAAAGGGAACCTGGCTGAGGGG - Intronic
1181103142 22:20554872-20554894 CCAGACTGACCATGGCTCAAAGG - Intronic
1181880194 22:25972936-25972958 ACAAAGTGACTCTGTCTCAAAGG + Intronic
1182375117 22:29841134-29841156 TCAAAGAGCACCTGGCTCAGTGG - Intergenic
1182451996 22:30427191-30427213 CCACAGTCACCCTGGCGCTGCGG - Exonic
1183597131 22:38819376-38819398 CCAAGGGGACCCTGGCCCTGGGG + Exonic
1183944771 22:41318979-41319001 TCAAAGTGAGCCAGGCGCAGTGG + Intronic
1185296261 22:50056809-50056831 CCAGAGTGGCCCGGGCTCAGAGG - Intronic
950538303 3:13594615-13594637 CTAAAGTGATCCTGGCTCCGTGG + Intronic
951033814 3:17911023-17911045 CCAAAGTACCCCTGGAACAGTGG - Intronic
954991172 3:54841893-54841915 CCAAAGGGGCCCTGGACCAGAGG - Intronic
956452749 3:69390553-69390575 CCAAAATGTCCCTGGTGCAGAGG + Intronic
961419055 3:126785305-126785327 GCAAAGTCACCCTGGGGCAGGGG + Intronic
964397757 3:156265429-156265451 CCAAAGAGGCCCTGATTCAGTGG + Intronic
964550260 3:157877564-157877586 CCAACCTGCACCTGGCTCAGAGG - Intergenic
964787581 3:160415216-160415238 CCAAAATTAGCCAGGCTCAGTGG + Intronic
967242717 3:187456753-187456775 ACACAGTGGCACTGGCTCAGTGG + Intergenic
969651183 4:8469259-8469281 CGAGAGTGGCCCTGGCTCAGTGG + Intronic
971191931 4:24436613-24436635 GCAATGTGACCCGGGCTCTGGGG - Intergenic
971922615 4:32961748-32961770 TCATATTGACCCTGCCTCAGTGG - Intergenic
972210532 4:36831290-36831312 TCAAAGTGAGCCATGCTCAGAGG - Intergenic
975252008 4:72191637-72191659 GCAAAGGGACCCTGGGTTAGGGG - Intergenic
975711315 4:77162669-77162691 CCAAAGTAAGCCGGGCACAGTGG - Intronic
977494722 4:97760698-97760720 GCATACTGACCCTTGCTCAGAGG - Intronic
979600711 4:122583922-122583944 CCAAAGTGTCCCGGGCTTTGGGG + Intergenic
981567902 4:146120059-146120081 CCAAGGTGAACCTGGTGCAGTGG + Intergenic
983071315 4:163270874-163270896 ACAAAGTGATCCTGAATCAGTGG - Intergenic
986669054 5:10127159-10127181 CCAGAGTGACACAGGCTTAGTGG + Intergenic
986699604 5:10393089-10393111 CCCAGGTGACCTTGGCTCAAAGG - Intronic
990694591 5:58401829-58401851 CCAGAGTGGTCATGGCTCAGGGG - Intergenic
993066403 5:83104132-83104154 ACAGAGTGCCCCTGTCTCAGTGG + Intronic
996226212 5:121000277-121000299 CCATGGTGACCCTTGCTAAGAGG - Intergenic
998461418 5:142313064-142313086 CCAAACCCAGCCTGGCTCAGCGG + Exonic
999227830 5:150041911-150041933 CCAAAGTGGAAATGGCTCAGAGG + Exonic
1003432451 6:6052617-6052639 CCCCAGTGACCCAGGCCCAGAGG + Intergenic
1003435163 6:6081474-6081496 CCACAGTGTCCAGGGCTCAGAGG - Intergenic
1005817133 6:29562685-29562707 CCAATGTGGCCCTGGCTGACGGG + Intronic
1006431030 6:33995954-33995976 CAAAAGTGTGCCTGGCACAGAGG + Intergenic
1009413423 6:63392400-63392422 CCAAAGGGACCCTGTCTCAGGGG + Intergenic
1014843783 6:126251181-126251203 CAAAAATGACCCAGGCACAGTGG - Intergenic
1015703596 6:136063280-136063302 CCATGGAGACTCTGGCTCAGTGG + Intronic
1017169643 6:151444506-151444528 CCAAAATGAAACAGGCTCAGGGG + Intronic
1017185721 6:151598450-151598472 ACAAAGTGACCCTCCATCAGAGG + Intronic
1017735393 6:157358234-157358256 CCTAAGGGAACCTGGCTAAGTGG + Intergenic
1019331900 7:464439-464461 CCAAAGTGCCCCTGGTACTGTGG + Intergenic
1019806976 7:3134896-3134918 CCAAAGTGACTCAGTCACAGAGG - Intergenic
1020130879 7:5557996-5558018 CCGGAGTGACCCTGGCCCCGGGG - Intronic
1022196596 7:28073592-28073614 CCAAAGAGACTGTGCCTCAGTGG - Intronic
1023625053 7:42107308-42107330 CGACAGTGACCCTGTCTCAAAGG + Intronic
1024449403 7:49521969-49521991 CCTAGGTTACCCTGGCACAGAGG + Intergenic
1025954369 7:66171019-66171041 CCTATGTGATCCTGGCTCACCGG - Intergenic
1026966208 7:74441758-74441780 CCCAGGTGACCCTGGCCCTGAGG - Intergenic
1029170749 7:98627647-98627669 CCAAATAGAACCTGGCACAGAGG + Intronic
1032294795 7:130626899-130626921 ACAGAGCGACCCTGTCTCAGAGG - Intronic
1032310488 7:130781692-130781714 CCAGAGAGAACCTGGCCCAGGGG - Intergenic
1032414429 7:131725479-131725501 CCCACCTGGCCCTGGCTCAGGGG + Intergenic
1033903733 7:146175179-146175201 CCAAGGTGACTCTGCCTCTGGGG - Intronic
1034584516 7:152077338-152077360 CAAAAGCGGCCCTGGGTCAGAGG - Intronic
1035004576 7:155645257-155645279 CCTAAGTGACACTGTCTCGGGGG - Intronic
1035425049 7:158765069-158765091 CCCAGGTGAGGCTGGCTCAGAGG + Intronic
1037826187 8:22162023-22162045 CCCAAGGGTCCCTGGCTTAGTGG - Intronic
1041914724 8:63127479-63127501 GGAGAGAGACCCTGGCTCAGAGG - Intergenic
1050638694 9:7641918-7641940 CCTAAGTCACCATGGCTTAGAGG - Intergenic
1051040957 9:12810223-12810245 CCAAAGGGACCCAGTCTCAGGGG - Intronic
1053484658 9:38442716-38442738 GCTAAGTGAGCCAGGCTCAGTGG - Intergenic
1057150828 9:92794422-92794444 CCAAAGTGGCCGTGGGGCAGTGG + Intergenic
1059251752 9:112892221-112892243 CCAAGGTGACCCTAGGTGAGGGG - Intergenic
1060184866 9:121558190-121558212 CCAAGGAAACCCAGGCTCAGAGG - Intergenic
1060265080 9:122107342-122107364 CAAAGGTCACCCTGGCTAAGAGG - Intergenic
1190022913 X:46895621-46895643 CCAAAATGATCATGGGTCAGTGG - Intronic
1192897542 X:75459763-75459785 CCAAACTGACCCTTCCTCATCGG - Intronic
1195223726 X:102771065-102771087 GCAAAGTGACCTTGGCTTAGGGG + Intergenic
1195778824 X:108438369-108438391 CCAAAGGGAAACAGGCTCAGCGG + Intronic
1195954603 X:110316838-110316860 ACAAACTGACCGTGGCTCTGTGG + Intronic
1196912797 X:120500778-120500800 ACAAAGTGACCCTGTCTCTCAGG + Intergenic
1198640566 X:138751365-138751387 TCAAAGTGATCCATGCTCAGAGG + Intronic
1199450911 X:147978190-147978212 CCAAAGTGGGCCAGGCGCAGTGG + Intergenic
1199750690 X:150814777-150814799 CCAGACTGACTCTGGCTCTGTGG + Intronic
1200054374 X:153451087-153451109 CCAAAGTGGCCGGGGCTCAAGGG + Intronic
1200342690 X:155415605-155415627 ACAAACAGACCATGGCTCAGTGG - Intergenic