ID: 908125877

View in Genome Browser
Species Human (GRCh38)
Location 1:61029835-61029857
Sequence AAGAAGAAGAAGTATGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1098
Summary {0: 1, 1: 0, 2: 13, 3: 126, 4: 958}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908125872_908125877 18 Left 908125872 1:61029794-61029816 CCAAGTATAGAGAAACTCACAGG 0: 1
1: 0
2: 0
3: 10
4: 194
Right 908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG 0: 1
1: 0
2: 13
3: 126
4: 958

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908125877 Original CRISPR AAGAAGAAGAAGTATGGGCC AGG Intronic
900033098 1:385436-385458 AGGAAGAAGAAGCCAGGGCCTGG - Intergenic
900053939 1:615326-615348 AGGAAGAAGAAGCCAGGGCCTGG - Intergenic
900153817 1:1195638-1195660 AAAAAAAAGAAGTATGGGCCGGG - Intronic
900332551 1:2143322-2143344 AAGACGAGGAAATATAGGCCGGG - Intronic
901075614 1:6553105-6553127 AAAAATATAAAGTATGGGCCAGG - Intronic
901192165 1:7419126-7419148 AAGAAGAAGAAGTTCGGGAAGGG - Intronic
901304655 1:8223878-8223900 CAGGAAAAGAAGTATGGGCCTGG - Intergenic
901530848 1:9851664-9851686 AAGAAAAAGAAGGATTGGCTGGG - Intronic
901572683 1:10174402-10174424 AAAAAGAAGAAGTATTGGGCTGG + Intronic
901585017 1:10282909-10282931 ATAAAGATGAAGTTTGGGCCGGG + Intronic
902153804 1:14466671-14466693 AAAAAGAAGAAGAAACGGCCAGG + Intergenic
902271455 1:15308023-15308045 AAGAAAAAGAGGTTTAGGCCGGG - Intronic
902369810 1:15998894-15998916 AAGAAAAAAAAATGTGGGCCAGG + Intergenic
902558955 1:17265057-17265079 AAGAAGAAGCAGTGAGGGGCAGG - Intronic
902883676 1:19389801-19389823 AAGAAGTTGGAGTTTGGGCCAGG - Intronic
903205714 1:21781119-21781141 AAAAAAAAAAAGTATCGGCCTGG + Intronic
903296563 1:22347084-22347106 AAGGAGAAGAAGAAGAGGCCGGG + Intergenic
903393402 1:22981143-22981165 AGAAAAAAGAAGTCTGGGCCAGG + Intergenic
903418068 1:23198074-23198096 AAAAAAAAAAAGTGTGGGCCGGG + Intergenic
903640085 1:24853373-24853395 AAGAAGGAAATGTGTGGGCCTGG - Intergenic
903669712 1:25028221-25028243 AAGAAGAGGAAGAAGGGGCTGGG - Intergenic
903696899 1:25214419-25214441 AAGAAAAAAAAATTTGGGCCGGG + Intergenic
903761082 1:25699326-25699348 AAGAAGAAGAAGCATGAGAGAGG + Intronic
903805425 1:26002021-26002043 AAGAAAAAGAATTTTAGGCCGGG + Intergenic
904537181 1:31207594-31207616 AAGAAGAACAAGAGTGGGGCAGG - Intronic
904662787 1:32097626-32097648 AAAAAAAAGAAGTTGGGGCCGGG - Intronic
904731531 1:32595951-32595973 AAGAAGTAAAATGATGGGCCAGG - Intronic
904740943 1:32675472-32675494 ATCAAAAAGAAGGATGGGCCAGG + Intronic
905156503 1:35987772-35987794 AAAAAAAAGACCTATGGGCCAGG + Intronic
905398651 1:37685368-37685390 AAAAAAAAGAATTTTGGGCCAGG - Intronic
905411134 1:37769004-37769026 AAGGAAAAGAAGTCTGGGCACGG + Intergenic
905477781 1:38240995-38241017 AAGTTGAAGAAGGATGGGCAAGG + Intergenic
905903664 1:41600055-41600077 AAGAAAAAGAAGTATTTGCAAGG + Intronic
906134163 1:43483844-43483866 AAGAAAAAGAAGTTTTGGGCTGG - Intergenic
906219282 1:44066019-44066041 AAAACTAAGAAGTATGGGCTGGG + Intergenic
906520326 1:46463116-46463138 GAAAAGAATAAGTATGGACCGGG - Intergenic
906745905 1:48222028-48222050 CAGAATAGGAAGTATGGGTCAGG + Intergenic
906922846 1:50083009-50083031 AAGATGAAAAAGCATTGGCCAGG + Intronic
906963056 1:50431052-50431074 AAGTTGAAGAAGGATGGGCCAGG - Intergenic
907166819 1:52419371-52419393 AAGAAGAAGAAGAATGGGTTTGG + Exonic
907184509 1:52599624-52599646 AAGAAGGAGCAGGATGGGCAGGG + Intergenic
907447591 1:54518936-54518958 AAGAAGAAGAAGGCTGCCCCAGG - Intergenic
907760961 1:57359431-57359453 AAAAATAAGAAGTATTGGCAAGG + Intronic
907786507 1:57618122-57618144 AAGGAGAAGAAGACTGGGCGCGG + Intronic
908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG + Intronic
908353711 1:63311246-63311268 AAGAAGAAGATGGCTGGGCGTGG - Intergenic
908744630 1:67363509-67363531 AAGAATAAGAATAATTGGCCGGG - Intronic
908897771 1:68919729-68919751 AAGAATATGAAAGATGGGCCTGG - Intergenic
909033462 1:70569348-70569370 AAGAAGAAGCAGTGTGTACCTGG + Intergenic
909602447 1:77474471-77474493 AAGCAGGAGAAGTAGGGTCCAGG + Intronic
910150327 1:84134653-84134675 AAGAAGAAGAAAAATAGGACGGG + Intronic
910433782 1:87184627-87184649 AAGAAGAAGAAAAATTAGCCAGG + Intergenic
910480546 1:87653944-87653966 AAGAAAAAGAAGGCTGGGCGCGG + Intergenic
910676205 1:89819683-89819705 AAGAAGGAGGTGTATGGGCAGGG - Intronic
910697741 1:90039074-90039096 GACAAAAAGAAGTATTGGCCTGG + Intergenic
910793269 1:91072989-91073011 AAGAAGAAGAAGAATGTGACTGG + Intergenic
910867613 1:91802654-91802676 TAGAAAAAGAAGTATGGGCCAGG - Intronic
911092601 1:94029734-94029756 GAGAATAAGAAGAAAGGGCCTGG - Intronic
911134220 1:94422061-94422083 AAGAAAAAGAAGTATCAGCTGGG - Intronic
911321203 1:96415662-96415684 AAGAAGAAGAAGTAAGGTCATGG + Intergenic
911441392 1:97930635-97930657 AGGAACAACAAGTGTGGGCCAGG - Intergenic
912161589 1:106992465-106992487 AAGAAAATGTGGTATGGGCCGGG + Intergenic
913034873 1:114954872-114954894 AAGAAAAAGAAATAAAGGCCAGG - Intronic
913154891 1:116086193-116086215 AAGAAAATGTAGTATAGGCCAGG - Intergenic
913359776 1:117967407-117967429 TAGAAGAAGAAGTATTGTCTTGG + Intronic
913370469 1:118093483-118093505 AAGAAGAAGAAGAAAGGTTCAGG - Intronic
914295293 1:146316186-146316208 AAAAAGAAAAATTATTGGCCGGG + Intergenic
914556334 1:148766969-148766991 AAAAAGAAAAATTATTGGCCGGG + Intergenic
914616503 1:149363264-149363286 AAAAAGAAAAATTATTGGCCGGG - Intergenic
914674462 1:149897827-149897849 AAAAAAAAGAATTTTGGGCCAGG + Intronic
915221201 1:154376033-154376055 AAAAAAAAGAAATATAGGCCGGG - Intergenic
915307730 1:154990310-154990332 AAGAAACAGAAGTAGGGGTCGGG - Intronic
915329448 1:155100993-155101015 AATAAAAAGAAATATGGGCCGGG - Intergenic
915372052 1:155359563-155359585 AAAAAGAAAAAGTCTGGGCATGG - Intronic
915377842 1:155413308-155413330 ACAAAGAAGGAGCATGGGCCAGG + Intronic
915721395 1:157988409-157988431 GTGAAGAAGAATTCTGGGCCTGG - Intergenic
915917568 1:159950168-159950190 AGGAACAAGAAGTATGTGCAGGG - Intergenic
915983499 1:160439153-160439175 AGGAAGAAAGAGCATGGGCCTGG - Intergenic
916146778 1:161746901-161746923 AAGAAAATGTGGTATGGGCCGGG - Intergenic
916259791 1:162829904-162829926 TAAAAGAAGAAATAGGGGCCAGG - Intronic
916505902 1:165428140-165428162 GAGGAGAAGAAGTATGTGCATGG - Intronic
917112192 1:171559814-171559836 AAAAATAATAGGTATGGGCCAGG - Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917490121 1:175491631-175491653 AAAAAAAAAAAGTCTGGGCCTGG - Intronic
917994625 1:180422501-180422523 AAAAAGAAAAGGGATGGGCCAGG - Intronic
918167396 1:181963319-181963341 AAAATTAAGAACTATGGGCCAGG + Intergenic
918733388 1:188027008-188027030 AAGAAAAAAAAGTACGGGCATGG - Intergenic
919485849 1:198146278-198146300 AAGAATAAGATATATAGGCCGGG - Intergenic
919789268 1:201279772-201279794 GAGAAGGAGAAGGCTGGGCCAGG - Intergenic
919904892 1:202071671-202071693 CAAATGAAGAATTATGGGCCGGG + Intergenic
920321434 1:205126161-205126183 AGGAAAATGAAGTAGGGGCCGGG - Intergenic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
921029167 1:211322269-211322291 AGGAAGAAGAAGTATGGAACTGG + Intergenic
921038796 1:211409020-211409042 AAAGAGAAGAAGTCTGGGCATGG + Intergenic
921343769 1:214160555-214160577 AAGGAGAAGAAGTATGGGTAGGG + Intergenic
921660178 1:217792008-217792030 AAGAAGAAGAAGAATTGTCTTGG + Intronic
921824165 1:219653122-219653144 AGTAAGAAGAAGGGTGGGCCAGG + Intergenic
921827832 1:219693714-219693736 GAGAAGCAGAAGTTTGGCCCTGG - Intronic
922405075 1:225304265-225304287 AAGATAAAGAAGTCTGGGCATGG + Intronic
922501977 1:226103942-226103964 AAAGAGAAAAAATATGGGCCAGG - Intergenic
922515182 1:226202379-226202401 AAAAAATACAAGTATGGGCCAGG - Intergenic
922651010 1:227338189-227338211 AAGAAGAAGAAGAAGAGGCTGGG + Intergenic
922984630 1:229856689-229856711 TAGAATAAGAAATATAGGCCAGG + Intergenic
923110047 1:230883136-230883158 CAGGAGAAGAAGTGTGGGCGGGG + Intergenic
923187187 1:231585704-231585726 AAGAAAAAAAAATATTGGCCGGG - Intronic
923329267 1:232907481-232907503 AAGAAGAAGAAGTAAGGGGCTGG + Intergenic
923352051 1:233117713-233117735 ATTAAGAAGAATTATAGGCCAGG + Intronic
923587097 1:235283069-235283091 AAAATGAAGTAGTATCGGCCAGG - Intronic
923675452 1:236077194-236077216 CAAAAGAAGACATATGGGCCGGG + Intergenic
923694432 1:236233319-236233341 AAAAAGAAGAAGGCTGGGCACGG + Intronic
923883732 1:238131994-238132016 AAGCAGAAGAAGGCAGGGCCAGG - Intergenic
924112667 1:240715258-240715280 TAGAAAAAGAGGTATAGGCCGGG + Intergenic
924150437 1:241124101-241124123 AAGAAGAACCAGGATGGGCATGG + Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
1062764495 10:50387-50409 AAGAAGAACGAAAATGGGCCAGG - Intergenic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063388778 10:5634874-5634896 AAGAAGAAGATGGGTGGGCTTGG + Intergenic
1063472899 10:6302673-6302695 AAAAACCACAAGTATGGGCCGGG - Intergenic
1064297504 10:14091726-14091748 AAGAAAACTAAGAATGGGCCAGG - Intronic
1064532412 10:16323778-16323800 AAGAAAAAGAGGTTTAGGCCAGG + Intergenic
1064898671 10:20269720-20269742 AAGAAGTAGGTGTTTGGGCCTGG + Intronic
1065219763 10:23484509-23484531 AAGAAAAATAAAAATGGGCCAGG - Intergenic
1065437820 10:25719845-25719867 ATGAAGAAGAAATTTGGGCTTGG - Intergenic
1065485485 10:26232791-26232813 ATGAAGAAGTAGTCTGGGCGTGG - Intronic
1065930043 10:30471329-30471351 AAAAAAAAGGAGTTTGGGCCGGG - Intergenic
1067541936 10:47161122-47161144 AAGAAGAAGAGGAGGGGGCCGGG - Intergenic
1068033547 10:51732218-51732240 AAGAAAAGGAAATTTGGGCCAGG - Intronic
1068983969 10:63090096-63090118 ATTAAGAAAAAGTATTGGCCAGG + Intergenic
1069240406 10:66131081-66131103 AAGAAGAAGAAGAAAAGCCCTGG + Intronic
1069351551 10:67532701-67532723 AAGGAGAAGAAAGATGGGACAGG + Intronic
1069455392 10:68549930-68549952 AAGAAGAAGAAGGCTGGGCGTGG + Intergenic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1069906158 10:71733750-71733772 AAGACGAAGGAGTAAGAGCCTGG - Intronic
1070014587 10:72513202-72513224 AAGAGGAAGAAGTATTGGTGAGG - Intronic
1070621968 10:78019876-78019898 AAAAAAAAAAAGTATGGGCTGGG + Intronic
1072112512 10:92336640-92336662 AAGAAGAAGAGGAAGGGGCATGG + Intronic
1072128895 10:92473223-92473245 AATAAAAAGAATTTTGGGCCGGG - Intronic
1072317073 10:94213526-94213548 AAGAGGAAGAGGTCTGGGTCAGG - Intronic
1072456907 10:95584454-95584476 TAGAACAAGGAGTATGGGCCAGG - Intergenic
1072538952 10:96383924-96383946 AAGAAAAAGAGGTTTAGGCCGGG - Intronic
1072879501 10:99211477-99211499 AAGAAAAAAAAGTATGGTACTGG + Intronic
1072919286 10:99562248-99562270 AAAAAGTAGAACCATGGGCCTGG - Intergenic
1074108243 10:110404501-110404523 AAGAAGAGTAAGTATGGCACTGG + Intergenic
1074443751 10:113501011-113501033 AAAAAAAAAAAGTTTGGGCCAGG + Intergenic
1074621354 10:115126351-115126373 AAAAAGAATAGGTCTGGGCCAGG - Intronic
1074744154 10:116514908-116514930 AAGGAGAGGAAGTATTGGCTGGG + Intergenic
1075382662 10:122031696-122031718 AAGAAAAAGGAGGCTGGGCCAGG - Intronic
1076094314 10:127718672-127718694 AAGAAAAAGAAAAATGGGCCGGG + Intergenic
1076563394 10:131381880-131381902 AAGACGAAGTCTTATGGGCCTGG - Intergenic
1077862161 11:6191817-6191839 AAAATGAAGAAGGATGGGCTAGG + Intergenic
1077868931 11:6245284-6245306 AAAAAGAAGAAGTATCTGCTCGG - Intergenic
1078069601 11:8099692-8099714 AAGAAGAAAAAGTAGGGGAGGGG + Intronic
1078138540 11:8672924-8672946 AAAAAAAAAGAGTATGGGCCAGG - Intergenic
1078583426 11:12558284-12558306 AGGAAGGTGAATTATGGGCCAGG - Intergenic
1078921515 11:15835242-15835264 AAGAAGGAGAAGTCTGGGCCGGG - Intergenic
1078961975 11:16286374-16286396 AAGAAGAAGAGGAATGCTCCTGG + Intronic
1079094008 11:17499608-17499630 CAGAAGAAGAAGGTGGGGCCTGG + Intronic
1079253676 11:18807997-18808019 AAAAAGAACAAGGCTGGGCCAGG - Intergenic
1079643545 11:22835316-22835338 AAAAAAAAAAAGTAGGGGCCGGG + Intergenic
1079910696 11:26306267-26306289 AAGAATAGGAAGAATAGGCCGGG - Intergenic
1080045455 11:27803151-27803173 AAGAAAAAAAAATATGGGTCTGG - Intergenic
1080325019 11:31061565-31061587 AAGAAGAAGAAGAAGGCACCTGG + Intronic
1081320369 11:41685079-41685101 AAGAATAAGAACTTTAGGCCAGG + Intergenic
1081467587 11:43336711-43336733 AAGAAGACAAAGTTTAGGCCGGG + Intronic
1081616085 11:44592112-44592134 GAAAAGAATAAGTATAGGCCGGG - Intronic
1081788276 11:45764073-45764095 AAGAAGATGAGGCAGGGGCCAGG + Intergenic
1082028731 11:47590113-47590135 AAGGAGAAGAAGTAGGCGCCGGG + Exonic
1082028815 11:47590572-47590594 AAGGAGAAGAAGTAGGCGCCGGG + Exonic
1082120084 11:48370689-48370711 AAGAAGAATCAGTAGGGGCTGGG - Intergenic
1082713179 11:56579795-56579817 AGGAAGCAGAAGTATTGGTCAGG + Intergenic
1082857717 11:57823974-57823996 AAGCAAAAGGAGTATGGGCAAGG + Intergenic
1083402923 11:62436639-62436661 AAAAAAAAAAAGTATAGGCCGGG + Intronic
1083577436 11:63802367-63802389 AAAAAAAAAAGGTATGGGCCTGG - Intergenic
1083919731 11:65775881-65775903 AAGAAAAAAAAGAAAGGGCCTGG - Exonic
1083952375 11:65964047-65964069 AACAAGAAGAAGCATGGCTCAGG - Intronic
1084102984 11:66962240-66962262 AAAAACAAGAACTAGGGGCCAGG - Intergenic
1084745367 11:71166776-71166798 AAAAAAAAGAAGTGTGGGCCCGG - Intronic
1085323385 11:75588528-75588550 TAGAAGAAAAAGTAGGGACCTGG - Intronic
1085373888 11:76040220-76040242 AAGAAGTAGAAGAAGCGGCCGGG + Intronic
1086498925 11:87432344-87432366 AAGAAAAATAAGTATTGGCCTGG + Intergenic
1086498985 11:87433004-87433026 AAGAAAAGTAAGTATTGGCCTGG - Intergenic
1086923236 11:92611688-92611710 AAGAAATAGAAGGGTGGGCCAGG - Intronic
1087752289 11:102020095-102020117 AAGAAGAAGAAGAAGAGGCCAGG + Intergenic
1088188771 11:107204291-107204313 AAGAAGAAGAAGATAGTGCCAGG + Intergenic
1088360550 11:108984766-108984788 ATGGAGCAGAAGCATGGGCCTGG + Intergenic
1088363074 11:109011442-109011464 AAGAAGAAGAAATTTGGACATGG + Intergenic
1088654482 11:111986349-111986371 AAAAAGAATAAGTATGGGGTGGG - Intronic
1089077236 11:115747941-115747963 AAGAAGAGCAAGGAAGGGCCGGG - Intergenic
1089308850 11:117544613-117544635 GAGAGGAAGAAGGATGGGCCTGG - Intronic
1089554016 11:119304918-119304940 AAGAATACGAAGTATGGGCCGGG - Exonic
1089715216 11:120352928-120352950 AAGAAGAAGGGGAATGGGCTGGG - Intronic
1091517683 12:1200851-1200873 AAGAAAAGGAAATGTGGGCCGGG - Intronic
1091727633 12:2856833-2856855 CAGCAGAAAATGTATGGGCCAGG + Intronic
1091828569 12:3533502-3533524 TAGAAGAAGAAGAATGGTCTTGG - Intronic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092368509 12:7897068-7897090 ATCAAAAAGAATTATGGGCCGGG + Intergenic
1092387343 12:8045952-8045974 AAAAATAAGAAATATGGGTCAGG - Intronic
1092797190 12:12124076-12124098 AAAAAAAAAAAGTATAGGCCAGG + Intronic
1093451557 12:19321666-19321688 AAAAAGAAAAAGTAGGGGGCTGG - Intronic
1094314752 12:29127302-29127324 AAGAAGAACATGTATTGGCCGGG + Intergenic
1094814287 12:34168099-34168121 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1095102637 12:38200490-38200512 AAGAAGAACAAAAATGGGCCAGG + Intergenic
1095196166 12:39320637-39320659 AAAAAAAAAAAGTCTGGGCCAGG + Intronic
1095355430 12:41267532-41267554 AAAAGGAAGAAGAAAGGGCCAGG + Intronic
1095481744 12:42643443-42643465 AATGAGAAAAAGTATGGGCCAGG + Intergenic
1095572545 12:43699711-43699733 AGGAAGAAGAGTTATGGGACAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096132359 12:49169916-49169938 AATAAGAAGAAGTACTGGCCAGG + Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1097604936 12:61742188-61742210 AATAAGAATAAATATGGGCTGGG - Intronic
1097643699 12:62211282-62211304 AAAAAGCAGAAAAATGGGCCAGG + Intronic
1098271558 12:68774952-68774974 AACAAGAAGACGTGTTGGCCAGG - Exonic
1098657982 12:73057209-73057231 AAGAATAAGAAGAATGGGCTTGG - Intergenic
1098949662 12:76626760-76626782 AAGGAGAGAAAGTATTGGCCAGG + Intergenic
1099362305 12:81719515-81719537 AGGAAGAAGAAGTATGACACAGG - Intronic
1100345422 12:93725153-93725175 AAAAATAATAAGTCTGGGCCGGG - Intronic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1101406687 12:104435034-104435056 AGGAAGAAGAAGGATGGATCTGG - Intergenic
1101636116 12:106542963-106542985 TAGAAATAGAAGTAGGGGCCAGG + Intronic
1101763315 12:107676953-107676975 AAGCAGAGGAAGGATGGGCTGGG - Intergenic
1102012651 12:109628149-109628171 AAAAATAAGAAGTTTGGGACAGG + Intergenic
1102167844 12:110820695-110820717 AAGAAGAAGAAGGAGGGGACTGG - Intergenic
1102703318 12:114859292-114859314 AAGAAGAGGAAGTAGAGGCAAGG - Intergenic
1102881004 12:116484925-116484947 AATAAAAACAAGTATGGGTCTGG - Intergenic
1102905939 12:116675364-116675386 AAGTAGATGGAGTGTGGGCCGGG - Intergenic
1103119451 12:118369025-118369047 AAGAAGAAGAAGAAAAAGCCAGG + Intronic
1103291135 12:119847277-119847299 ATTAAGAAGAAGTTCGGGCCAGG - Intronic
1103314353 12:120040380-120040402 AAGAAAAAGAAGGCTGGGCTCGG - Intronic
1103449977 12:121021833-121021855 AAGAAAAAGAAATATAAGCCTGG + Intronic
1103529643 12:121591950-121591972 AAGAAAAAGAAAAATAGGCCGGG + Intergenic
1103712446 12:122922952-122922974 AAGAAGAAGAAAAATTAGCCAGG - Intronic
1103766614 12:123284675-123284697 AAAAACAAGAATAATGGGCCGGG - Intergenic
1105406391 13:20136023-20136045 AAAAAAAATAAGTAAGGGCCGGG - Intergenic
1105493781 13:20912359-20912381 AAAAAAAAGAAGGCTGGGCCTGG + Intergenic
1105537976 13:21287623-21287645 AAGAAGAAGAGGTAATGGGCCGG - Intergenic
1105575809 13:21650568-21650590 AAGAGGAAGAAGGAGGGGGCTGG - Intergenic
1105967720 13:25399695-25399717 AAAAAGAAGAACCACGGGCCGGG - Intronic
1106066147 13:26352509-26352531 AAGAAGAAGATTCTTGGGCCGGG - Intronic
1106205250 13:27587223-27587245 AGGAATGAGAAGGATGGGCCAGG - Intronic
1106246487 13:27954356-27954378 AAGAAGAAAAAGAAAGTGCCCGG + Intergenic
1106800154 13:33248107-33248129 AAGAAGAAGAAGGCTGGGCATGG + Intronic
1107198739 13:37687256-37687278 AAGAAGTAGAACTTTGGGCTGGG - Intronic
1108431965 13:50362246-50362268 AAGAAGAAGACCTCTCGGCCAGG - Intronic
1108723690 13:53158787-53158809 AAGAAGAAGAAGGAAGGGCAGGG - Intergenic
1109023404 13:57129320-57129342 AAAAAGAACAAATTTGGGCCGGG + Intergenic
1110261117 13:73486240-73486262 AAGAAAAAGAGGGCTGGGCCTGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111113030 13:83739964-83739986 AATAAGAAGAAATATAGGGCTGG - Intergenic
1111522815 13:89427788-89427810 AAAAATAAGCAGTATGGGCTGGG + Intergenic
1111590058 13:90334602-90334624 TAGAAAAAGAAATATGGGGCGGG - Intergenic
1112928383 13:104705366-104705388 AAGAAGATGAAGTATGGACCTGG - Intergenic
1113345350 13:109472363-109472385 AAGAAGAAGAAGAAGGGGAAAGG + Intergenic
1113387374 13:109861402-109861424 AAAAAGGGGAGGTATGGGCCAGG + Intergenic
1113432477 13:110262619-110262641 AAGAAGAGGAAGCATGGCCCAGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114227981 14:20756093-20756115 AAGAGAAAGAAGGCTGGGCCTGG - Intergenic
1114290203 14:21281802-21281824 AAAAAAAAGAAGTCTGGGCAGGG + Intergenic
1114355422 14:21902977-21902999 AAGAACAAGAAGTGTGGGGAAGG - Intergenic
1115275658 14:31606046-31606068 AAGAAGAAGAAGAATGGAGGAGG - Intronic
1115341610 14:32298689-32298711 AAGAAGCAGCAGTTTGGGGCTGG + Intergenic
1115414856 14:33120252-33120274 AGAAATAAAAAGTATGGGCCAGG - Intronic
1115685433 14:35791609-35791631 AAAAAAAAAAAGTATGGGCTGGG + Intronic
1115831752 14:37350370-37350392 AAGAAAAAGCAGAATGGGCTGGG - Intronic
1116306942 14:43268109-43268131 AAGAAGAAGAAGAAAGGAACTGG + Intergenic
1116824620 14:49660591-49660613 AACAATAAAAAGTTTGGGCCAGG + Intronic
1116891476 14:50272876-50272898 AAGAAGAAAAAATATAGGCCAGG + Intronic
1116966817 14:51023371-51023393 AAGAAGAAAAAGGATGGCACTGG + Intronic
1117373356 14:55098848-55098870 AAAGGAAAGAAGTATGGGCCAGG + Intergenic
1117473623 14:56071566-56071588 AAGCAGAAGAAGGACAGGCCAGG - Intergenic
1117818676 14:59625120-59625142 ATGATGAAGAAGGAAGGGCCTGG + Intronic
1118077781 14:62319881-62319903 AAGAAGCAGAAGGATGGGTGAGG - Intergenic
1118585076 14:67344944-67344966 AACAAGAAGAAGCAGGGGCCGGG + Intronic
1118806921 14:69246001-69246023 AGGAAGCAGAAGTAGGGGCCGGG - Intergenic
1119493812 14:75061804-75061826 TAGAAAAAGAGGTATTGGCCGGG + Intronic
1119493860 14:75062133-75062155 AAGAAAAAGAGGTATTGGCTGGG + Intronic
1119535759 14:75401353-75401375 AAAAAGAACAAGGAAGGGCCAGG - Intergenic
1119728045 14:76933940-76933962 AAAAAAAAAAAGTACGGGCCAGG + Intergenic
1119757419 14:77128895-77128917 AAGAAAAGGAAGGATGGGCAGGG - Intronic
1119774904 14:77242309-77242331 AAGAGGAAGAAATGTGGGTCTGG - Intronic
1119948561 14:78720484-78720506 AAGTAAAAGAAGTCTGGGGCAGG - Intronic
1120757916 14:88261460-88261482 AAGAAGAAAAGGGATGGGCGTGG + Intronic
1120808422 14:88777679-88777701 AAAAAGCAGGAGGATGGGCCGGG + Intronic
1121174805 14:91882998-91883020 CAGGAGCAGAAGTATGTGCCGGG + Exonic
1121202268 14:92128241-92128263 AAAAAGAAAAAAAATGGGCCAGG + Intronic
1122165038 14:99816592-99816614 CAGAAGAAGACCTATGGACCAGG - Intronic
1123813852 15:23956178-23956200 AAAAATAAAAAGTTTGGGCCGGG - Intergenic
1123852314 15:24371649-24371671 AAGAAAAAGAAGTGAAGGCCAGG - Intergenic
1124185198 15:27519063-27519085 AAGAAGAGGAGGTATTGGCACGG + Intronic
1124272803 15:28298498-28298520 AAGAAGAAGAAATACTTGCCAGG + Intronic
1124824219 15:33077328-33077350 AAAAAAAAAAAGGATGGGCCGGG - Intronic
1125630143 15:41140650-41140672 AAAAAAAAAAAGTATGGGACGGG - Intergenic
1125663066 15:41409337-41409359 AAAAAGAAAAAATGTGGGCCGGG - Intronic
1125666127 15:41431792-41431814 AAAAAAAAAAAGTATGAGCCAGG - Intronic
1125823469 15:42654984-42655006 AAAAAGAACAAATCTGGGCCAGG + Intronic
1125933878 15:43618213-43618235 AGGAAGAAGAAATGTTGGCCAGG + Exonic
1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG + Intergenic
1125951654 15:43757563-43757585 AAAAAAAAAAAGTGTGGGCCAGG + Intronic
1126034409 15:44533749-44533771 AAAAAGAAGAAGGCTGGGCGCGG - Intergenic
1126816827 15:52461966-52461988 AAAAAAAAAAAGTTTGGGCCAGG + Intronic
1126961295 15:53998096-53998118 AAAAAGAACAAGATTGGGCCAGG - Intergenic
1127516694 15:59701135-59701157 AAGAAGAGGCAGTCTTGGCCAGG - Intergenic
1128486511 15:68095824-68095846 ATGAAGAAAAAGAATGGGCCAGG - Intronic
1128755004 15:70176880-70176902 TATAAGAAGACTTATGGGCCGGG + Intergenic
1128972318 15:72118279-72118301 AAGAAGAAAAAATTTGGGCGGGG - Exonic
1129131869 15:73505825-73505847 AAGAAGGAGAAGTGCAGGCCGGG - Intronic
1129285632 15:74522331-74522353 AAGAAAAAAAAGAATGGGCTGGG + Intergenic
1129293779 15:74588246-74588268 AAAAAGAAGAAGAAGAGGCCTGG + Intronic
1129501346 15:76040620-76040642 AAAAATAATAACTATGGGCCTGG + Intronic
1130075457 15:80685355-80685377 AAGCCGAAGAAGTATGGGCATGG + Intronic
1130209428 15:81909646-81909668 AGGATGAAGAAGGAGGGGCCAGG + Intergenic
1130658234 15:85808317-85808339 AAGAAAAAGAGGTTTGGGCCGGG - Intergenic
1130793871 15:87187969-87187991 AAGAAGAAAAAATGTGGGCCAGG + Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131492227 15:92873067-92873089 AAAAAGAAACATTATGGGCCAGG - Intergenic
1131501406 15:92970495-92970517 AATAATAATAATTATGGGCCAGG - Intronic
1131593307 15:93772262-93772284 AGAAAGGAGAGGTATGGGCCGGG + Intergenic
1131660965 15:94515440-94515462 AAGAGGAAGATGTGTGGTCCAGG - Intergenic
1132387442 15:101410402-101410424 GAGAAGGAGAACTATGTGCCAGG + Intronic
1132811794 16:1803073-1803095 AAAAAAAAAAAGTGTGGGCCGGG - Intronic
1133163040 16:3924710-3924732 AAGAAAAAGAATTTTGGGTCAGG + Intergenic
1133563882 16:6974638-6974660 AAGAATATGATTTATGGGCCAGG - Intronic
1134068744 16:11247380-11247402 AAAAAGAAGAAGGAGAGGCCGGG - Intergenic
1134120494 16:11580752-11580774 AAGAAAAAGGAATAGGGGCCTGG - Intronic
1134283969 16:12843932-12843954 AAAAAGATGAAGTATTGGCTGGG - Intergenic
1135161099 16:20097116-20097138 AAAAGGAAGAAGTGTGGGGCTGG - Intergenic
1135549505 16:23387440-23387462 AAAAAGAAAAAATGTGGGCCAGG + Intergenic
1135704254 16:24661034-24661056 AAGAAGAAGAAAGCTGGGCAGGG - Intergenic
1135710950 16:24716667-24716689 AAGAAAAAAAAGTCTGGGCATGG + Intergenic
1135953560 16:26937273-26937295 AAGAAAAAGAGGTTTAGGCCGGG - Intergenic
1136005736 16:27327475-27327497 AATGAGCAGAAGCATGGGCCTGG - Intronic
1136427137 16:30176388-30176410 AAAAAGAAGAAAGAAGGGCCGGG + Intergenic
1137061759 16:35797107-35797129 AGGAAGAGGAAGTATAGGACAGG - Intergenic
1137354145 16:47743121-47743143 AAGAAGGAGAAGAATGGGGCTGG - Intergenic
1137406170 16:48191238-48191260 AAGAATAAGAGAAATGGGCCAGG + Intronic
1137476386 16:48813002-48813024 TAGCAGAAGAAGGATGGCCCTGG + Intergenic
1137923766 16:52519660-52519682 AAGAAGTAGTAGAATGGGCTGGG + Intronic
1138176181 16:54900237-54900259 TAGAAGGAGAAGCATGGGACTGG - Intergenic
1138550086 16:57742995-57743017 AAGATGAAGAGGAATAGGCCGGG + Intronic
1138933866 16:61695067-61695089 AAGAAGAAGAAGGCCGGGCATGG - Intronic
1139424415 16:66870396-66870418 AAGAAAAAGAAGCATAGGCCGGG + Intronic
1139533040 16:67552800-67552822 AAGAAGCAAGAGTCTGGGCCTGG + Intergenic
1139699060 16:68695982-68696004 CAGGAGAACAAGCATGGGCCTGG + Intronic
1139724571 16:68886804-68886826 CAAAAAAAAAAGTATGGGCCAGG - Intronic
1139741246 16:69036978-69037000 AAAAAGAAGAAGGCTGGGCATGG + Intronic
1139876526 16:70150398-70150420 AGGAAGAAAGACTATGGGCCCGG - Intronic
1140073494 16:71674371-71674393 AAAAAAAAAAAGTCTGGGCCTGG - Intronic
1140463186 16:75158081-75158103 AAAAAAAGGAGGTATGGGCCAGG - Intronic
1140766883 16:78168228-78168250 AGGAAGAGGAAGAATGGGCAGGG - Intronic
1141073322 16:80978572-80978594 AAGAAGAAGAACAAAAGGCCAGG + Intronic
1141269114 16:82522828-82522850 AAGAACAAGAAGTGTGGGTGAGG - Intergenic
1141395981 16:83705330-83705352 AAGAAAAAGAAGCCCGGGCCCGG + Intronic
1141459814 16:84171474-84171496 AAAAAGGAAAAGTAGGGGCCTGG + Intronic
1141637126 16:85320110-85320132 AAGGAGAAGCAGTCGGGGCCGGG + Intergenic
1142357716 16:89610903-89610925 AATAAAAAAAATTATGGGCCAGG - Intergenic
1142440156 16:90092858-90092880 AAGAAGAACAGAAATGGGCCAGG + Intergenic
1142853751 17:2718333-2718355 AACAAGAAGAGGCCTGGGCCAGG + Intergenic
1143097376 17:4485689-4485711 AAGAAGATGAACTCTGGGCCAGG - Intronic
1143310597 17:5985387-5985409 AAGAAGAGGAAATTTGGGCCGGG + Intronic
1143341342 17:6213750-6213772 AAGCAGAAGAAGACTGGGCACGG - Intergenic
1143350952 17:6288035-6288057 TATAAGAGGAAGTATGGGCCAGG - Intergenic
1143656626 17:8298103-8298125 AAGAAGAAAAAGTTTAGGCCGGG - Intergenic
1143846455 17:9775903-9775925 AAGAAGAGGAAATTTGGGGCCGG + Intronic
1143859018 17:9874363-9874385 AAGAAGAAGAACTTGGGGCTGGG + Intronic
1144334108 17:14254148-14254170 CAGAAGAAAAAGTCTAGGCCCGG + Intergenic
1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG + Intronic
1144608862 17:16690734-16690756 AGGAAGAAGAGGTAATGGCCAGG + Exonic
1144866858 17:18341343-18341365 AAAAACAAGAAGTAGGGGCTGGG + Intronic
1144903961 17:18625092-18625114 AGGAAGAAGAGGTAATGGCCAGG - Intergenic
1145082186 17:19903197-19903219 AAGAAAAAGAATTTTGGGCTAGG - Intergenic
1145128624 17:20321650-20321672 AGGAAGAAGAGGTAATGGCCAGG + Intergenic
1145195998 17:20895665-20895687 AGGAAGAAGAGGTAATGGCCAGG - Exonic
1145221839 17:21095959-21095981 AAGAAAATCAAGTATGGGGCTGG + Intergenic
1146006681 17:29164926-29164948 AAGGAGAAAAAGCATGGACCTGG - Intronic
1146112477 17:30102529-30102551 AAAAAGAAGACATAAGGGCCGGG - Intronic
1146801500 17:35827408-35827430 AAGAAGAAGGGGCATGGGCCAGG + Intronic
1146953865 17:36924713-36924735 AAAAAAAAAAAGAATGGGCCTGG - Intergenic
1147114798 17:38290939-38290961 AAAAAGAAAAAGTAGGGGGCTGG - Intergenic
1147118360 17:38319805-38319827 AAGAATAAGAACTTGGGGCCGGG + Intronic
1147298023 17:39500340-39500362 AAGAAGAAAAAGGCTGGGCGCGG + Intronic
1147416292 17:40292637-40292659 AAGAAAAAGAAGGCTGGGCATGG + Intronic
1147432335 17:40379972-40379994 AAGAAAAAGAAGTTTTGGCCAGG - Intergenic
1147880096 17:43647812-43647834 AGGAAGAAGAAGTCTGGGTTGGG + Intronic
1148171076 17:45520344-45520366 AAGTGGAAGAAGCATGGGCTTGG + Intergenic
1148358294 17:46991329-46991351 AAAAAGAAACAGTATAGGCCAGG + Intronic
1148364946 17:47048208-47048230 AAGTGGAAGAAGCATGGGCTTGG - Intergenic
1148501381 17:48094131-48094153 AAAAAAAAGAAGTGTGGGCTTGG + Intronic
1148568847 17:48650564-48650586 ATTAAGAAGTAGTATTGGCCAGG + Intergenic
1148634293 17:49135551-49135573 AAAAATAAGAAGGATGGGCCGGG - Intronic
1148839049 17:50483046-50483068 AAGAAAAAGAAAAAAGGGCCTGG + Intronic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1148931305 17:51129414-51129436 AAAAAGAAAAAGTATGGGAGTGG + Intergenic
1149048696 17:52278651-52278673 AAGAAACATAAGAATGGGCCGGG - Intergenic
1149424281 17:56540041-56540063 AAAAACAAGAAGTATGTTCCAGG + Intergenic
1149749050 17:59127920-59127942 AAGAAAATGGAGTATGGGCCGGG + Intronic
1150045518 17:61909402-61909424 AAAAATAAGAAGTAAGGGCTGGG - Intronic
1150046698 17:61920475-61920497 AAAAAAAAAAAGTATAGGCCAGG - Intronic
1150074659 17:62182193-62182215 AAGAAGAAAATGCATTGGCCAGG - Intergenic
1150309365 17:64115253-64115275 AACAGGAAGAAGTATGAGGCAGG - Intronic
1150431559 17:65122550-65122572 AAGATGAGGAACTATGAGCCTGG - Intergenic
1150769477 17:68029129-68029151 AAAAAGAAAAAGAAAGGGCCGGG + Intergenic
1150948742 17:69777604-69777626 AAGAAGAAAAAGAGTAGGCCTGG - Intergenic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1151584809 17:75002698-75002720 ATGAAGAAGAGGTGTGGGCAGGG + Intronic
1151643724 17:75415292-75415314 AAGAAGAAGAGATTGGGGCCGGG + Intergenic
1151762568 17:76114247-76114269 AAAAAAAAAAACTATGGGCCGGG + Intronic
1151772426 17:76172994-76173016 AAGAAAAAGAAGGCTGGGCGCGG + Intronic
1152348706 17:79770826-79770848 AAGAAAAAGAAATATGGGGAGGG + Intergenic
1152408736 17:80111584-80111606 AGGAAGTACAAGGATGGGCCTGG + Intergenic
1152478787 17:80536423-80536445 AAGAAAAAGAAAAATGGGGCCGG - Intergenic
1152643157 17:81457562-81457584 AAGAAGAAGAAGGAGAGGCAGGG + Exonic
1152957396 18:50703-50725 AAGAAGAACAAAAATGGGCCAGG - Intronic
1153297339 18:3560123-3560145 AAGAATGAGAAAAATGGGCCAGG + Intronic
1153622471 18:6991683-6991705 AAGAAGTAGAATTATTGGCTGGG - Intronic
1153652200 18:7250714-7250736 TTAAAGAAGAAATATGGGCCGGG - Intergenic
1155016800 18:21850495-21850517 AAGTAGAAGAAGCAGGGGCAAGG - Intronic
1155201574 18:23522537-23522559 AGGAAGAAGAAGAATGGTCTTGG - Intronic
1155372816 18:25121246-25121268 AAGAAGAAGAAGGCTGGGCGCGG - Intronic
1155498541 18:26465377-26465399 AAGAAAAGAAAGAATGGGCCGGG - Intronic
1155863270 18:30931775-30931797 AACAATAAAAAATATGGGCCGGG + Intergenic
1155948766 18:31885561-31885583 GAAAATAAGAAATATGGGCCGGG + Intronic
1156328687 18:36098944-36098966 AAGAAGAAGAACAAGCGGCCGGG - Intergenic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156713612 18:39978495-39978517 CAGAAGAAAAAGCATGGGCGTGG + Intergenic
1157269855 18:46264700-46264722 AAGAAGAAGAAGAACAGGCTGGG - Exonic
1157526595 18:48387650-48387672 AAGAAGAGGAAATATGAGCCTGG + Intronic
1157707147 18:49816694-49816716 TAGAAAAAGAATAATGGGCCAGG - Intronic
1157830242 18:50850830-50850852 AAGAGGAAGAAGTCTGAGCTAGG + Intergenic
1158186052 18:54773039-54773061 AAAAAAAAGAAGTATAGGCATGG - Intronic
1158342351 18:56480390-56480412 AAGAAAAAGAAAAAAGGGCCAGG + Intergenic
1158510945 18:58090131-58090153 AAGAAAAGGAAGTTTGGGCTGGG - Intronic
1158633204 18:59133947-59133969 AAGAAGAGGAAGCTTGAGCCAGG + Intergenic
1158696517 18:59708839-59708861 AAGAAGAAGGAAGGTGGGCCGGG - Intergenic
1158701889 18:59755558-59755580 AAGAAGAAGAAGGCTGGGTGTGG + Intergenic
1159028482 18:63208044-63208066 AAGAAGAGGAAGTAATCGCCAGG - Intronic
1159269318 18:66128495-66128517 ATGTAGCAGGAGTATGGGCCAGG - Intergenic
1159610214 18:70516605-70516627 ATAAAGAAGAAGTATTGGCTGGG + Intergenic
1159839885 18:73386950-73386972 ACGAAAAAGAAGAATAGGCCAGG + Intergenic
1160367719 18:78342795-78342817 AAGAATAAGAAAAATAGGCCAGG + Intergenic
1160951729 19:1670854-1670876 GAGAAGAAAAAGAGTGGGCCGGG - Intergenic
1161274130 19:3405896-3405918 AAGAAAAAGAAAAAGGGGCCGGG - Intronic
1161357522 19:3827305-3827327 AAGATGAGGACGCATGGGCCTGG + Intronic
1161369304 19:3901195-3901217 AAGAAGATGAAGGATAGGCCGGG - Intronic
1161564030 19:4989629-4989651 AAGAAGAAGAAGACTGGGCATGG - Intronic
1162049664 19:8025293-8025315 AAGAATAGGAAGAAGGGGCCGGG - Intronic
1162583063 19:11542176-11542198 AAGAAGAAGAAGGTCGGGCGAGG - Intronic
1162742421 19:12781010-12781032 AAGAAAAAGAAGGCTGGGCGCGG + Intronic
1162950038 19:14065845-14065867 AAGAAGAAGAAGGCTGGGCGCGG + Intergenic
1163235660 19:16029093-16029115 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
1163342836 19:16720846-16720868 AAAAAGAAAAAGTCTCGGCCAGG - Intronic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164079531 19:21850570-21850592 AAAAAGAAAAAGAAAGGGCCTGG + Intronic
1164130093 19:22354031-22354053 AAGAAAAGAAAGTATTGGCCTGG - Intergenic
1165615435 19:37195729-37195751 AAGAAGAATTAGTCTTGGCCGGG + Intronic
1165619850 19:37236546-37236568 AAGAAGAAAAAGAATTAGCCAGG - Intronic
1165688751 19:37845757-37845779 AAGAAGAATGAGTATCTGCCTGG + Intergenic
1165729759 19:38137482-38137504 AAAAAAAAAAAATATGGGCCAGG - Intronic
1165878225 19:39024817-39024839 AAAAAAAAAAAGTTTGGGCCAGG - Exonic
1165960637 19:39531466-39531488 AACAAAAAAAAGTATCGGCCGGG - Exonic
1166073094 19:40397924-40397946 AAGAAGAAGAAGATGGTGCCTGG - Exonic
1166131258 19:40747100-40747122 AGGAATAATAAGCATGGGCCGGG - Intronic
1166136558 19:40780688-40780710 AAGAAAAAGAGGTAGGGGCCAGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166642800 19:44508683-44508705 AAAAAGAAGAAAACTGGGCCAGG - Intronic
1166680424 19:44762813-44762835 AAAATGAAGAAATTTGGGCCTGG - Intergenic
1166967824 19:46540892-46540914 AAGAAGAGGAAATTTAGGCCGGG - Intronic
1167070179 19:47217177-47217199 AAAAAGAAGAAAGATCGGCCGGG - Intergenic
1167177766 19:47877528-47877550 AAGAAAAAGAAGGCTGGGCACGG - Intronic
1167242693 19:48354247-48354269 AAAAAGAAAAAGTCTGGGCGCGG - Intronic
1167415111 19:49365914-49365936 AAAAAGAAAATGTTTGGGCCTGG - Intronic
1167530390 19:50012265-50012287 GGGATGAAGAAGAATGGGCCAGG - Intronic
1167786633 19:51643212-51643234 AAGTAGAAGGGGTATGGGGCAGG + Exonic
1167864486 19:52313431-52313453 AAAAAAAAGAATTATAGGCCAGG - Intronic
1168002338 19:53459179-53459201 TAAAAGAATAATTATGGGCCGGG + Intergenic
1168012117 19:53541399-53541421 TAAAAGAAGAAATATAGGCCGGG - Intronic
1168054205 19:53852562-53852584 AAGAAGAAGAAGGCTGGGCACGG - Intergenic
1168058254 19:53875552-53875574 AAAAAGAAGGAGTCGGGGCCGGG + Exonic
1168105570 19:54163954-54163976 AAGAAGAAGAAGAAGAGGCCGGG - Intronic
1168133115 19:54333488-54333510 AAGGGGAAGAAGCATGGGTCAGG - Exonic
1168167899 19:54565567-54565589 AAGAATAGTAATTATGGGCCAGG - Intergenic
1168723204 19:58566149-58566171 AAAAAGAAGAGGAATGGGCCAGG + Intronic
925234384 2:2265301-2265323 AAAAAAAAAAAGGATGGGCCAGG - Intronic
925741518 2:7009215-7009237 AAGAAGAACTAGTATTTGCCGGG + Intronic
926169862 2:10546168-10546190 AAAAAGAAAAATTCTGGGCCAGG - Intergenic
926563370 2:14442264-14442286 AAAAAGAACAAGTGTGCGCCAGG + Intergenic
926661896 2:15476425-15476447 ATGAAAATGAATTATGGGCCGGG + Intronic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926750157 2:16192437-16192459 AAAAAAAAAAAGAATGGGCCAGG - Intergenic
926858421 2:17282236-17282258 AAGAAGAACAGGTTTGGGCATGG + Intergenic
926900739 2:17749392-17749414 AAGAAGAAAAATTAATGGCCGGG + Intronic
927147346 2:20175019-20175041 AAAAAAAAGAATTCTGGGCCAGG + Intergenic
927584742 2:24291781-24291803 ATAAAGCAGAAATATGGGCCGGG - Intronic
927678570 2:25124759-25124781 AAAAAGGAGCAGTAAGGGCCAGG + Intronic
927715654 2:25350511-25350533 AAGAAGAAGAAGAATGGCACTGG - Intergenic
927770431 2:25856352-25856374 AAAAAAAAAAAGTATAGGCCAGG - Intronic
927882221 2:26696866-26696888 AAGTAGAAGGAGTAGGGGACTGG - Intronic
928628309 2:33164053-33164075 AAGATTAAGAATAATGGGCCGGG + Intronic
928681850 2:33710842-33710864 AAGAAAAAGAATTAGAGGCCAGG + Intergenic
928754144 2:34503502-34503524 TAGAAGAAATAGTATCGGCCAGG - Intergenic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
929850234 2:45580976-45580998 AAGAAGTAGAAGAATTGGCTGGG - Intronic
929871980 2:45766742-45766764 CAAAAGAAAAAGTCTGGGCCGGG + Intronic
929895610 2:45958212-45958234 AAGAAAAAGAAAATTGGGCCAGG + Intronic
930110302 2:47673256-47673278 AACAAGAAGAAGCCTGGGCATGG - Intergenic
930125064 2:47789217-47789239 AAGAAATAGCAGTATGGGCCGGG - Intronic
930140911 2:47950581-47950603 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
930889499 2:56366847-56366869 AAGAAGGAGAAATCTGGACCAGG - Intronic
931468139 2:62510318-62510340 TAAAGAAAGAAGTATGGGCCAGG + Intronic
931731219 2:65155103-65155125 AAAAAGGAGAATTATGGGCTGGG - Intergenic
932266833 2:70374891-70374913 AAGAAGAATTAGCAAGGGCCAGG - Intergenic
932576793 2:72966795-72966817 AAGAGGAAGCACTGTGGGCCTGG - Intronic
932909620 2:75792016-75792038 AAGAAGGAGGACTATGGGACAGG + Intergenic
933130839 2:78672812-78672834 AATAAGAATAAGGATGGGCCGGG + Intergenic
933333882 2:80929416-80929438 AAGAAAAAGAAGGATGGGCACGG + Intergenic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933867108 2:86530286-86530308 AAGATGAAGAGTTCTGGGCCAGG - Intronic
934075849 2:88428150-88428172 AAGAAAAAGAAGGACAGGCCGGG + Intergenic
934101506 2:88657493-88657515 AAGAGGAAGAATTCTGGGGCGGG + Intergenic
934164578 2:89282528-89282550 AAAAAGAAGAAGGTGGGGCCGGG - Intergenic
934166279 2:89297206-89297228 AGGAAGCAGATGTATGGGGCTGG - Intergenic
934200997 2:89885250-89885272 AGGAAGCAGATGTATGGGGCTGG + Intergenic
934202696 2:89899996-89900018 AAAAAGAAGAAGGTGGGGCCGGG + Intergenic
934770691 2:96906177-96906199 AAAAAGAAAAAGTATTGGCTGGG - Intronic
935189984 2:100769466-100769488 AAGGAGAAGAGGTAAGGTCCTGG + Intergenic
935417194 2:102831459-102831481 AAGAAGAAGAGTGGTGGGCCAGG + Intronic
935997460 2:108789295-108789317 TAGAAAAGGAACTATGGGCCAGG + Intronic
936041488 2:109153509-109153531 AAGCAGAGGAAGCATGGGCTCGG + Intronic
936150000 2:110011511-110011533 AAGAAGAAAAAAAATGGGACAGG + Intergenic
936194676 2:110359858-110359880 AAGAAGAAAAAAAATGGGACAGG - Intergenic
936401762 2:112169943-112169965 AAGAAAAGGAAGAAGGGGCCAGG + Intronic
937250876 2:120522914-120522936 AAGAACAAGCAGCATGGGGCTGG + Intergenic
937424219 2:121784820-121784842 AAAAATAAAAAGTATGGGCTGGG - Intergenic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
938020332 2:127901151-127901173 AAGAAGAGGAAGGAGTGGCCGGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938457206 2:131474385-131474407 AAGAAGAAGAAGACTGGGCGCGG - Intronic
938476876 2:131624078-131624100 AAGAAAATGAATTCTGGGCCGGG + Intergenic
939154249 2:138505459-138505481 AAGAAAAAAAATTATAGGCCAGG + Intronic
939765501 2:146243702-146243724 AAGAAAAAAAAGTATTGGCCAGG + Intergenic
939811052 2:146832626-146832648 ATCAAGAAGAATTATGGGCTGGG - Intergenic
940316495 2:152332972-152332994 AAAAAGAAAATGTCTGGGCCGGG - Intergenic
940688358 2:156882898-156882920 AAGAAGAAGATGTATTAGTCTGG + Intergenic
940725199 2:157328910-157328932 AAGAATAATAACTAGGGGCCAGG - Intergenic
940789120 2:158013289-158013311 ATGAAAAAGAATTATTGGCCAGG - Intronic
940837173 2:158535714-158535736 AAAAATAATAATTATGGGCCAGG - Intronic
940975843 2:159943264-159943286 TAAAAGAACAAGTCTGGGCCGGG - Intronic
941171325 2:162140840-162140862 AAGAAGAAGAAATGTAGGCAAGG - Intergenic
941691562 2:168505074-168505096 GAGAAAAAGAAATATGAGCCTGG + Intronic
941915347 2:170809280-170809302 AACATGAAGTAGAATGGGCCAGG - Intergenic
942020505 2:171863228-171863250 TATAAGAAGAAAAATGGGCCAGG + Intronic
942184551 2:173412406-173412428 AAGAATAATAAGTAGGGGTCGGG - Intergenic
942226773 2:173823434-173823456 AAAAAGGAGACGTTTGGGCCAGG - Intergenic
942486070 2:176441064-176441086 AAAAAGAGGAAATTTGGGCCAGG - Intergenic
942581091 2:177417594-177417616 AAGAGGAAGAATTATGAGACTGG + Intronic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
942958813 2:181805240-181805262 ATAAAGAAGAAGTATGGGCTTGG + Intergenic
943470307 2:188287468-188287490 AAAAAGTAGTAGTATGGGCCGGG + Intergenic
943536877 2:189163164-189163186 AAGAAGGAGAACAATGGGACAGG - Intronic
943797420 2:192013744-192013766 AAAAAAATCAAGTATGGGCCAGG - Intronic
944302549 2:198140146-198140168 TTAAAAAAGAAGTATGGGCCAGG - Intronic
944397263 2:199282174-199282196 AAGAAGAGAGAATATGGGCCGGG - Intronic
944574483 2:201078312-201078334 AAGAAGAAGAAGTTAGGAGCAGG + Intronic
944908392 2:204285427-204285449 AGGAAGCAGAAGTGGGGGCCTGG + Intergenic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945243655 2:207698864-207698886 AAGAAGAGGAAGTTTGTGCCAGG - Intergenic
945418845 2:209609001-209609023 CAGAAGAAAAAGTATGTGTCAGG - Intronic
946747046 2:222856603-222856625 ATGAAGAAGAAGAGTTGGCCGGG + Intergenic
947287616 2:228533963-228533985 AAAAAGAAGAAGGCTGGGCATGG + Intergenic
947513736 2:230783120-230783142 AAGAAAGAGCAGTCTGGGCCGGG - Intronic
947675465 2:231975405-231975427 AAAAAGATGAGGGATGGGCCGGG + Intronic
947752231 2:232539117-232539139 AAGAAGAAGAAAAATTAGCCAGG + Intergenic
947898266 2:233695412-233695434 AAGAAGAAGAAGGCCGGGCGCGG - Intronic
947958698 2:234216535-234216557 AAGAAGAAGAAGTGTGAGACTGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168763862 20:368577-368599 AAGAAGATGAAGAATGGGCCGGG - Intronic
1168974644 20:1954943-1954965 AAAAAAAAGAAGAAGGGGCCAGG - Intergenic
1169070051 20:2720389-2720411 AAAGAAAAGAAGAATGGGCCGGG - Intronic
1169137486 20:3206091-3206113 AAAAAGAAAAAATATGGGCTGGG + Intergenic
1169243290 20:4003262-4003284 AAAAAGAAAAATTCTGGGCCGGG - Intronic
1169359981 20:4940019-4940041 TAGAAGAATAAGCAAGGGCCAGG + Intronic
1169633797 20:7664543-7664565 AAGAAGAAACAATAAGGGCCTGG - Intergenic
1169768417 20:9174438-9174460 AAAAAAAAGAAGAATAGGCCAGG - Intronic
1170283849 20:14683172-14683194 AAAAAGAAGAAATAAAGGCCGGG - Intronic
1170298409 20:14854719-14854741 AAGAAAAAGACAAATGGGCCGGG + Intronic
1170429784 20:16265446-16265468 AAGGAGAAGGTGTGTGGGCCTGG + Intergenic
1170532648 20:17309898-17309920 AAGAAGAAGAAGAAAGGGAAGGG + Intronic
1171119928 20:22559264-22559286 ATGAGGAAGGAGTATGGGCCTGG - Intergenic
1171184520 20:23115422-23115444 AAGAAAAAGAGGTAGGGGTCAGG - Intergenic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1171775483 20:29363476-29363498 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1171817501 20:29801281-29801303 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1171900843 20:30854816-30854838 AAGAAGAATAAAAATGGGCCAGG + Intergenic
1172154585 20:32814897-32814919 AAAAAGAAGAAGAATTGGCTGGG + Intergenic
1172161409 20:32871145-32871167 AAGAAGAAGTAGAGAGGGCCGGG - Intronic
1172238162 20:33392528-33392550 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1172489592 20:35324678-35324700 AAGAAAAATAAGTATTGGCAAGG + Intronic
1172565220 20:35924894-35924916 AAAAAAAAGAAAAATGGGCCAGG - Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172907972 20:38383390-38383412 TAGATGAAGAAGTCTGGGCGTGG + Intergenic
1172926579 20:38542568-38542590 AAGAAGACCATGTGTGGGCCAGG + Intronic
1172972702 20:38885061-38885083 AAGAAGAAGAAGACTGGGCGTGG + Intronic
1173198648 20:40937771-40937793 AAGAAAAGGAAGAAGGGGCCAGG + Intergenic
1173219681 20:41121780-41121802 AAGACGAAGAAGTATGTACCTGG + Exonic
1173816344 20:45991446-45991468 ATCAAGAAGTAGGATGGGCCAGG + Intergenic
1173904938 20:46619718-46619740 AAGAAGCAGAAGAATGTTCCTGG - Intronic
1174001027 20:47374821-47374843 AAGAAGAAGAAGGCTGGGCGCGG + Intergenic
1174001269 20:47376554-47376576 AAGAAGAAGAAATCTAGGCTAGG + Intergenic
1174055140 20:47793477-47793499 AAGAAGAGAAAGTGGGGGCCAGG + Intergenic
1174198435 20:48789947-48789969 AAGAAGGAGAAAAATGGGCCTGG + Intronic
1174600364 20:51719437-51719459 AAAAAGAAGAAACATGGGCCAGG + Intronic
1174617836 20:51849986-51850008 AAAAAGAAGATGTATGTTCCCGG + Intergenic
1174778560 20:53367859-53367881 AAGAATAAGAAGGCTGGGCGTGG - Intronic
1175098154 20:56558490-56558512 AAAAAGAATGAGTAGGGGCCAGG - Intergenic
1175104817 20:56607363-56607385 AATAAAAAGAAGACTGGGCCAGG + Intergenic
1176317307 21:5258330-5258352 AAAAAGAACAAGTATTGGCCAGG - Intergenic
1177605346 21:23370666-23370688 AAAAAGAATAAATATGGGCCAGG + Intergenic
1177778326 21:25594856-25594878 AGGAAGAACAAGTTTGGGCGGGG - Intronic
1178096109 21:29217450-29217472 AATAAGAGGACGTGTGGGCCGGG + Intronic
1178146601 21:29747533-29747555 AAGAATAGAAAGCATGGGCCAGG + Intronic
1178221028 21:30660295-30660317 AAGAATAACAAGTATTGGCAAGG + Intergenic
1178273477 21:31215293-31215315 AAGAAGAAGAGAAATGGGCCAGG + Intronic
1178275346 21:31231718-31231740 ATGAAAAAGAGTTATGGGCCAGG + Intronic
1178474506 21:32925450-32925472 AAGAGGAAGATGTATGGTCCAGG + Intergenic
1178846099 21:36175404-36175426 AAGAAGAGGAAATCTGGGCCAGG - Intronic
1179592271 21:42416637-42416659 AAGAAGCAGATGAATGGGCTGGG + Intronic
1179834445 21:44020418-44020440 AAAAATAAGAAAAATGGGCCAGG - Intronic
1180236604 21:46464001-46464023 AAAATTAAGAATTATGGGCCAGG - Intronic
1180242882 21:46523538-46523560 AAAAAAAAGCACTATGGGCCAGG - Intronic
1180320836 22:11319940-11319962 AAGAAGAACAAAAATGTGCCAGG - Intergenic
1180334213 22:11560803-11560825 AAGAAGAATAAAAATGGGCCAGG + Intergenic
1180390049 22:12221733-12221755 CAAAAGAAGAAATATTGGCCTGG - Intergenic
1180415887 22:12712736-12712758 CAAAAGAAGAAATATTGGCCTGG + Intergenic
1180740755 22:18051771-18051793 AAGAAGAAGAAGCCTGGACATGG + Intergenic
1181367027 22:22385550-22385572 AAGGACAAAAAGTATTGGCCGGG - Intergenic
1181424883 22:22828354-22828376 AAGAAGTAGAGGAATGGGCCGGG + Intronic
1181579301 22:23818448-23818470 AAGAAAACAAAGTATTGGCCAGG - Intronic
1181691766 22:24566555-24566577 GAAAAGAACAACTATGGGCCAGG - Intronic
1181922517 22:26331686-26331708 TAAAACAAGAAGTCTGGGCCAGG + Intronic
1182160667 22:28118101-28118123 TAAAAAAAGAATTATGGGCCAGG + Intronic
1182367971 22:29791387-29791409 AAGAAGAAGAAGGCTGGGTGTGG + Intronic
1182512597 22:30829613-30829635 AATAAGTAGAGGTAAGGGCCCGG - Intronic
1182687267 22:32130889-32130911 AAGAAAAGGAAGAATGGGCCGGG + Intergenic
1183159365 22:36101481-36101503 AAGAAAAAGAAGTTTAGGCTGGG - Intergenic
1183178839 22:36244979-36245001 AAGAAGGAGAACTTTGGCCCTGG - Intergenic
1183562540 22:38586971-38586993 AAATAGAAGAAGTGTAGGCCAGG - Intronic
1183570021 22:38646078-38646100 AAGATAAAGAAATATGGGCTAGG - Intronic
1183644990 22:39120178-39120200 AAAAAAAAGAAGAAAGGGCCGGG - Intronic
1183896827 22:40976072-40976094 AAAGAGAAGAAGTGAGGGCCGGG - Intergenic
1184104016 22:42357089-42357111 GAGAAGAGGAAGGGTGGGCCAGG + Intergenic
1184223822 22:43117663-43117685 AAAAAAAAAAAATATGGGCCGGG - Intronic
1184224807 22:43123456-43123478 AAGAAGAAAAAGGCTGGGCGTGG + Intronic
1185165070 22:49256529-49256551 AAGAAGAGGATAAATGGGCCAGG + Intergenic
1185362446 22:50416624-50416646 AAGAAAAAAAAGTGTAGGCCAGG - Intronic
1185419161 22:50725825-50725847 AGGGAGGAGAAGGATGGGCCTGG - Intergenic
949993105 3:9595577-9595599 AAGAAGAAGAAGTCTAGGTGCGG - Intergenic
949994872 3:9608657-9608679 AAGAAAAAGAGGTTTAGGCCAGG + Intergenic
950099636 3:10348898-10348920 AATAAGAATAAGGATGGGCTGGG + Intronic
951132329 3:19062575-19062597 AAGAACAAAAGATATGGGCCTGG + Intergenic
951339606 3:21468628-21468650 AAGAATACGTAGTATGGGCAGGG + Intronic
951835945 3:26983691-26983713 AAACTGAAGAAGTAGGGGCCAGG - Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952633370 3:35497264-35497286 AAGAATAAGAAAAATAGGCCAGG + Intergenic
952739514 3:36722189-36722211 AAAATGAAGAAGTATGGGGCAGG + Intronic
952747381 3:36794066-36794088 ATGAAGAAGACATGTGGGCCGGG - Intergenic
952767217 3:36964442-36964464 AAGAAAAATAAGTATTGGCAAGG - Intergenic
953170139 3:40499778-40499800 AAGAAGAAACAGGATGTGCCTGG - Intergenic
953222884 3:40989456-40989478 AAGAAGTTCAAGTATGGCCCAGG - Intergenic
953801387 3:46026563-46026585 AAGAAGAAGAAAAATGGATCTGG - Intronic
953853673 3:46484855-46484877 GAAAGGAAGATGTATGGGCCTGG + Intronic
954183808 3:48901577-48901599 AAAAAAAAGAATTATGGGCCGGG + Intergenic
954185811 3:48916357-48916379 AAAAAGAAAAAGTTTTGGCCAGG - Intergenic
954551997 3:51489491-51489513 AAGAAAAAGAAATATAGGCTGGG + Intronic
954936925 3:54335046-54335068 AGGAAGTAGAACTATGTGCCAGG - Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955238084 3:57157380-57157402 AAGACAAAGGAGTAGGGGCCTGG - Intronic
955267688 3:57463111-57463133 AACAAGAAGAATGAAGGGCCAGG + Intronic
955486391 3:59438825-59438847 AGGAAGAAGAAGGAGGGGTCTGG + Intergenic
956291773 3:67668139-67668161 AACAAGTAGAAGTTTGGGGCAGG - Intergenic
957475655 3:80720010-80720032 AAGAAGAAGAAATGTGTGCTAGG + Intergenic
957528732 3:81412560-81412582 AAAAAGAAAAAATCTGGGCCGGG - Intergenic
958031487 3:88116223-88116245 AAAAATAAGATATATGGGCCAGG + Intronic
958035446 3:88164819-88164841 AAGTATAAGAACTAGGGGCCAGG - Intronic
958894680 3:99816534-99816556 AAAATTAAGAAGTATGGGCCGGG - Intergenic
959093688 3:101930643-101930665 AAAAAGAGGAAACATGGGCCAGG - Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960394380 3:117118324-117118346 AAGAAGAAAAACAATAGGCCCGG - Intronic
960912772 3:122665938-122665960 AAAGAGAAGCAGTAGGGGCCTGG + Intergenic
961080113 3:124019495-124019517 AAGAAGAAGAACTTTGGAACAGG - Intergenic
961084798 3:124057631-124057653 AAGCAGAAGGAGCCTGGGCCTGG + Intergenic
961468202 3:127094278-127094300 GATAAAAAGAATTATGGGCCAGG - Intergenic
961856225 3:129874097-129874119 AAGGAGGAGAAGTAAGGACCAGG + Intronic
962370868 3:134819842-134819864 AAGAGCAAGAAGTATGGGATGGG - Intronic
962815701 3:138996181-138996203 AAGAAGAAAAAGTATTGCCAAGG - Intergenic
963153349 3:142070200-142070222 GAAAAAAAGAAGTTTGGGCCAGG - Intronic
963281553 3:143389515-143389537 AAGAAGGAGAAGCATGTGCCTGG + Intronic
963831230 3:150011807-150011829 AAGAAGAAGAAGGCCGGGCGTGG + Intronic
963847803 3:150177746-150177768 AAAAGGAAGAAGTATTGCCCAGG + Intergenic
963999294 3:151749774-151749796 AAGTAAAAAAAGTCTGGGCCGGG - Intronic
964093882 3:152908842-152908864 AAGAATAAGAAGGCTGGGCGTGG - Intergenic
964335477 3:155649681-155649703 AAGAAGTAGAATTAATGGCCGGG + Intronic
965899619 3:173622551-173622573 AAGAAGAAGAAAAATAGTCCCGG + Intronic
966129899 3:176625445-176625467 AAGAATGAGAAGCATCGGCCGGG + Intergenic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
966262844 3:178000930-178000952 AAAAAAATCAAGTATGGGCCAGG - Intergenic
966705278 3:182906796-182906818 AAGAAGAAGAAGGCCGGGCATGG + Intronic
966827829 3:183979868-183979890 AAAAAAAAAAAGTATTGGCCGGG - Intronic
966937458 3:184721001-184721023 AAGAAAAAGAAGAACGGTCCAGG - Intergenic
967069219 3:185947356-185947378 AGGAAGAAGGAGTTTGGGCAGGG + Intergenic
967142313 3:186571100-186571122 AGGAAGGGGTAGTATGGGCCAGG + Intronic
967207501 3:187137515-187137537 AAGAAAAAGAAAAATTGGCCGGG + Intronic
967463764 3:189778160-189778182 AAGAAGAATAAGACTCGGCCAGG - Intronic
967533056 3:190571214-190571236 AAGAAGTATAACTATGGGCCAGG + Intronic
967633572 3:191775558-191775580 AAGAAAAAGAAATGTGGGTCTGG - Intergenic
968021625 3:195396490-195396512 AGAAAAAAGAAGTATGGGCCGGG + Intronic
968076277 3:195817425-195817447 AAGAAGAAGGAGGCTGGGCCGGG - Intergenic
968164531 3:196453905-196453927 AAAAAAAAGAAGCATTGGCCAGG - Intergenic
968210617 3:196845642-196845664 AAGAAGAAGAAGGCCGGGCACGG - Intergenic
968216225 3:196893612-196893634 AAGAAGAGTAAGTTTAGGCCGGG + Intronic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
968700795 4:2057384-2057406 AAGAATGAAAAATATGGGCCGGG - Intergenic
969915564 4:10487868-10487890 AAGAAACAGAAGTATGGGTATGG - Exonic
970244997 4:14051532-14051554 AACAAGAAGAATTACAGGCCAGG + Intergenic
970462712 4:16291427-16291449 GAGAAGAAGAAATAAGTGCCTGG + Intergenic
970489307 4:16555918-16555940 AAGAAGAAGAAGAAGGGCCATGG - Intronic
970694673 4:18663537-18663559 TAGAAGGAGAAAAATGGGCCAGG + Intergenic
970899666 4:21144001-21144023 CAGAATAAGAACTCTGGGCCTGG - Intronic
970948129 4:21719665-21719687 AAGAAGAAACAATAGGGGCCAGG + Intronic
971045707 4:22802832-22802854 AAGAACTTGAGGTATGGGCCTGG - Intergenic
971275454 4:25192269-25192291 AAGAAGAAGAAGATAAGGCCAGG - Intronic
971323027 4:25620692-25620714 TAAAAGAAGAAGGCTGGGCCAGG - Intergenic
971788296 4:31134164-31134186 TAAAAGAAGTAGAATGGGCCAGG + Intronic
972039680 4:34577234-34577256 CAGGAGAAGAATAATGGGCCGGG - Intergenic
972239950 4:37179491-37179513 AAGAAGAAGAAATCTGAGCTAGG + Intergenic
972305212 4:37824277-37824299 AAAAAAAAAAAGTCTGGGCCTGG + Intergenic
972947754 4:44278735-44278757 ACGGAGATGAGGTATGGGCCTGG - Intronic
973165001 4:47066032-47066054 AACTATAAGATGTATGGGCCAGG + Intronic
973195232 4:47432092-47432114 AGGAAGAAGAAGCAAGAGCCAGG - Intergenic
973242470 4:47971271-47971293 AGGAAGGGGAAGTATGGGACTGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973609658 4:52623628-52623650 AAAAACAAAAAGTAGGGGCCAGG + Intronic
973609972 4:52626616-52626638 TAAAAGTTGAAGTATGGGCCAGG - Intronic
973688391 4:53398859-53398881 AAGAGGGAGAAGGCTGGGCCTGG + Intronic
973823393 4:54682723-54682745 AAGACAAAGAAATATCGGCCGGG - Intronic
973997816 4:56477586-56477608 AAAGAGAAGAACTATGGGCTGGG - Intronic
975686618 4:76922192-76922214 AATAAAATGAGGTATGGGCCAGG + Intergenic
976193219 4:82508759-82508781 ATAAAAAAGAAGTACGGGCCAGG - Intronic
976244638 4:82994993-82995015 AACAAGAAAAGGTCTGGGCCAGG + Intronic
976497915 4:85751794-85751816 GAGAGGAAGAAATATGGACCTGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976710669 4:88067628-88067650 TAAATGAAGAAATATGGGCCAGG - Intronic
977088722 4:92641433-92641455 AAGAAAAAAAAATATTGGCCAGG - Intronic
977106261 4:92889245-92889267 AAGAAGCAGAAGTTCTGGCCAGG + Intronic
977202207 4:94130537-94130559 AAAAAAAAAAAGTATGGGGCAGG - Intergenic
977290621 4:95160964-95160986 AAGAAAAAGCAGCATTGGCCAGG - Intergenic
977371271 4:96139783-96139805 AAGAAGTAGAAGCATGCACCTGG + Intergenic
977776905 4:100931576-100931598 TAAAACAAGAAGTATTGGCCAGG + Intergenic
978119872 4:105065524-105065546 AAGATGAAGAAGGAAGGGGCAGG + Intergenic
978268530 4:106858866-106858888 AAGAAGAAGAAGAAGGGGAAGGG + Intergenic
978387295 4:108188913-108188935 AAGGTGAAAAGGTATGGGCCAGG - Intergenic
978467839 4:109028429-109028451 ATGAAGAAGAAAAAGGGGCCAGG + Intronic
978574966 4:110180705-110180727 AAGAAAACAAAGTATAGGCCAGG - Intronic
978786606 4:112616539-112616561 AAGAAACACAATTATGGGCCAGG + Intronic
979201887 4:117988321-117988343 ATGAAGATGAAGTATTTGCCAGG - Intergenic
979246329 4:118509139-118509161 AAGAATAGTAAGTATAGGCCAGG - Intergenic
980409501 4:132398314-132398336 AAAAAGAAGTTGTATCGGCCTGG - Intergenic
980476508 4:133324463-133324485 AAGAATTAAAAGTAGGGGCCAGG - Intergenic
980758469 4:137196830-137196852 AAAAATAAGTATTATGGGCCAGG - Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
980922656 4:139102543-139102565 AAAAAAAGGAAGTATCGGCCGGG + Intronic
981475780 4:145185257-145185279 AGAAAAAAGAATTATGGGCCAGG - Intergenic
981769726 4:148294679-148294701 AAAAAAAAAAAGCATGGGCCAGG + Intronic
981893235 4:149764499-149764521 AAGAGAGAGATGTATGGGCCTGG - Intergenic
981957036 4:150490092-150490114 TAGAAGAAGAGGTATGTGCCAGG + Intronic
982037909 4:151364647-151364669 AAGATGATGAATTATAGGCCAGG + Intergenic
982080762 4:151787236-151787258 AAAAAAAGGAAGTATGGGCCAGG - Intergenic
982791814 4:159600839-159600861 AAAAAAGAGTAGTATGGGCCAGG - Intergenic
982934256 4:161451037-161451059 AAAATGAAGATGAATGGGCCGGG - Intronic
983021683 4:162684529-162684551 ATAAAGAATAAATATGGGCCAGG + Intergenic
983126277 4:163955043-163955065 AAAAATAAGAAATATGGGCATGG - Intronic
983471124 4:168156796-168156818 AAAAACAAGAAATAGGGGCCGGG - Intronic
983622664 4:169776372-169776394 AAGAAAATGAAGTTGGGGCCAGG + Intergenic
984285089 4:177718923-177718945 AATAAAAAAAAGTATGGGCCGGG + Intergenic
984838129 4:184041044-184041066 AAGAAGAGGAAATTTGGGCTTGG + Intergenic
984886605 4:184455281-184455303 AAGAAGAAGAAGGAAGGGAGGGG - Intronic
984974069 4:185214933-185214955 AAGAACTAGAATAATGGGCCTGG + Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985279561 4:188271788-188271810 AAGAAGAAGAAGGGAGGGCCGGG - Intergenic
985283062 4:188306156-188306178 AAGAAAAAAAAGTTTTGGCCGGG + Intergenic
985285280 4:188330771-188330793 AAGTATCAGAAGTGTGGGCCTGG - Intergenic
985441671 4:189986013-189986035 AAGAAGAACAGAAATGGGCCAGG - Intergenic
986134450 5:4961097-4961119 AAGAAGAATATTTTTGGGCCAGG - Intergenic
986362441 5:6993221-6993243 AAGAAGAAGAAGAAAGGAGCGGG - Intergenic
986647377 5:9930598-9930620 AAGAAGAGGAAGAGTTGGCCGGG - Intergenic
986918041 5:12648362-12648384 AAGAAAAAGAGGTTTCGGCCGGG - Intergenic
986960331 5:13202883-13202905 AAGAAGAAGTTTGATGGGCCTGG - Intergenic
987070554 5:14333467-14333489 AATCAGAAGAATGATGGGCCAGG - Intronic
987387977 5:17348185-17348207 AAGCAAAAGAAGCAGGGGCCTGG + Intergenic
987435070 5:17884268-17884290 TAGAAGAAACAGTGTGGGCCAGG - Intergenic
988020599 5:25615139-25615161 AAAAAAAAAAAGAATGGGCCAGG - Intergenic
988246500 5:28689079-28689101 AAGAAGAAGAAGCTATGGCCGGG - Intergenic
988272564 5:29035379-29035401 AAGAACAAGAACCATGGTCCTGG + Intergenic
988331363 5:29844777-29844799 TAGAAATAGAAATATGGGCCGGG + Intergenic
988854607 5:35215738-35215760 TAGAAATAGAAGTAAGGGCCGGG + Intronic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989985839 5:50696971-50696993 AAGAAGAATGAGTCTGTGCCGGG + Intronic
990068003 5:51742220-51742242 AAGAAGAAGACCCATGGTCCAGG - Intergenic
990285560 5:54297767-54297789 AAGTAGAAGATGGAAGGGCCTGG - Intronic
990578328 5:57145300-57145322 AATAATAATAACTATGGGCCAGG - Intergenic
990767270 5:59198731-59198753 AAGTAGAAGAAGGATGGGAGGGG - Intronic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
991724437 5:69522124-69522146 AAAAATAAGAAGTCTGGGCATGG - Intronic
992684439 5:79185809-79185831 AAGAAAAAAAAGTATAGGTCAGG + Intronic
992735207 5:79712506-79712528 AAGAAGAAAAAAAATAGGCCGGG - Intronic
993631726 5:90293936-90293958 AAGAAAAAGAAGTTTGAGGCTGG - Intergenic
993852110 5:93023488-93023510 AAGAAGATGAGTTATGGGCAAGG + Intergenic
994082039 5:95717715-95717737 GAGAAGAGGAAGAACGGGCCTGG + Intronic
994111282 5:96007608-96007630 AAGAAGAGGAAGATGGGGCCGGG + Intergenic
994324815 5:98436392-98436414 AAGAAAAAGGAGCATTGGCCGGG - Intergenic
995610737 5:113908105-113908127 AAGAACAGGAAGTTTGGGCTGGG + Intergenic
995777050 5:115734899-115734921 AAGGAGAAAAAGGATGTGCCAGG + Intergenic
996196994 5:120620951-120620973 GAGAAAGAGAATTATGGGCCTGG - Intronic
997519722 5:134515076-134515098 AATAATAAAAAGTATGGGGCTGG - Intergenic
997714912 5:136035326-136035348 AATAAGAAAAAAGATGGGCCGGG + Intronic
998137879 5:139683965-139683987 AGGAGGAAGAAGGATGGCCCAGG + Intergenic
998552096 5:143087625-143087647 AAAAAAAAAAAGAATGGGCCAGG - Intronic
999279970 5:150358539-150358561 AAGAATGAGAGGGATGGGCCGGG + Intronic
999286365 5:150396587-150396609 AAGAAGAAGAAGCTGGGGGCCGG + Exonic
999835253 5:155363547-155363569 AAGGAGGAGAAAGATGGGCCAGG - Intergenic
1000153546 5:158527839-158527861 AATAAAAAGAAGTATGTGTCTGG + Intergenic
1000822199 5:165998435-165998457 AAGAAGAATAAGAAAGGGCTTGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1001993576 5:176135788-176135810 GACAAGAAGAAGTCAGGGCCAGG - Intergenic
1002286015 5:178163211-178163233 AAGAAAAAGAAGAGTGAGCCTGG + Intergenic
1002451351 5:179320611-179320633 CAGAAGGAGAAGGGTGGGCCAGG - Intronic
1002530191 5:179839836-179839858 AAGAACAAGACAAATGGGCCAGG + Intronic
1002740722 5:181433432-181433454 AGGAAGAAGAAGCCAGGGCCTGG + Intergenic
1002969410 6:1998413-1998435 AAGAAGAGGAAGAAAGGGACAGG + Intronic
1003468467 6:6404993-6405015 AAAAAGAAATACTATGGGCCGGG - Intergenic
1003900039 6:10646061-10646083 AAGAATAACATGTTTGGGCCAGG - Intergenic
1004133977 6:12948973-12948995 AAGAAATAGAAAAATGGGCCAGG + Intronic
1004227936 6:13804477-13804499 AAAAAGTAGAAGTCTTGGCCGGG + Intronic
1004255159 6:14057134-14057156 AAGAAAAAGAAAAATTGGCCAGG + Intergenic
1004271912 6:14203223-14203245 AAGAAGAAGGCTTATGAGCCGGG - Intergenic
1004383941 6:15155926-15155948 AATAAACAGAAATATGGGCCAGG - Intergenic
1004405330 6:15327758-15327780 AAGAAGCAGATGAATGGGCTTGG + Intronic
1005765265 6:29005267-29005289 AAGAATAAAAAGAATGGGTCAGG + Intronic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006002202 6:30973989-30974011 AAGAAGAAGAAGAAGAGGCCGGG + Intergenic
1006089371 6:31619354-31619376 AAAAAAAAGAAGGATGGGCGCGG - Intergenic
1006339079 6:33436303-33436325 AAAAAGAATCAGTAAGGGCCTGG - Intronic
1006498052 6:34438232-34438254 TATAACAAGAAGTTTGGGCCTGG + Intergenic
1006607057 6:35265527-35265549 AAGAAGAAGAAGAAAATGCCAGG + Intronic
1007246482 6:40466921-40466943 AAGAAGTAAAAGTATGGACATGG + Intronic
1007342183 6:41198288-41198310 AGGAAGAAGAAGTGTGAGCCTGG - Exonic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1007919369 6:45592487-45592509 AAGAGGAAGAAATAGGGGTCTGG + Intronic
1008052359 6:46913205-46913227 AAGAAGAAGGGGGCTGGGCCAGG + Intronic
1008065640 6:47044919-47044941 AAGAAGAAGAAGAAAGGCCTGGG + Intergenic
1008331268 6:50247421-50247443 AATATTAAGAAGTATAGGCCGGG + Intergenic
1008602270 6:53107767-53107789 AAGAAGCAGTAGCTTGGGCCGGG + Intergenic
1008694865 6:54023863-54023885 AAAAATAAGTGGTATGGGCCAGG - Intronic
1009559681 6:65222924-65222946 ATGAAGAAGAAGTAAGAGTCAGG + Intronic
1009831216 6:68938341-68938363 AACAAGTAGAAGTAAGGACCAGG + Intronic
1009953287 6:70421177-70421199 AAAAAAAAGTAGTGTGGGCCAGG - Intronic
1011133248 6:84073248-84073270 AGGAAGAAGAAGAAAGGCCCTGG - Intronic
1011660655 6:89591395-89591417 ACGAATAAGAAGTTTGGGCCAGG - Intronic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012754382 6:103206196-103206218 ATAAAGAAGAAGTATAGGTCAGG - Intergenic
1012957893 6:105590555-105590577 AAGAAGAGGAGGCATAGGCCGGG + Intergenic
1013128990 6:107213468-107213490 AAGAAAAAGAAGGGTGGGCATGG + Intronic
1013449490 6:110265690-110265712 AAGAAGAAGGATTATATGCCAGG + Intronic
1013518951 6:110915108-110915130 AAAAAAAAAAAGTATTGGCCAGG + Intergenic
1013743673 6:113319457-113319479 AAAAAGAAGTATTATTGGCCAGG + Intergenic
1014222669 6:118814053-118814075 AAGAAGAGAGAGTATGAGCCAGG - Exonic
1014680927 6:124429341-124429363 AAAAAGAAAAAATATGGGCCAGG - Intronic
1014789810 6:125659512-125659534 AAAAAGAAAAAATATGGGCGGGG + Intergenic
1014835645 6:126157192-126157214 AAGAAGAGGAAGTGTGGACGAGG - Intergenic
1015131371 6:129814143-129814165 AAGAGGAATACGTATTGGCCAGG + Intergenic
1015725842 6:136298499-136298521 AAGAAGAATAAGGATGGGTATGG + Intergenic
1015829362 6:137351232-137351254 AAAAAGGAGAAAAATGGGCCAGG + Intergenic
1015917652 6:138233670-138233692 GAGTAAAAGAAGTATTGGCCGGG - Intronic
1016393520 6:143598569-143598591 TAAAAGCAGAAGTGTGGGCCAGG + Intronic
1016439573 6:144069250-144069272 AAGAAAAAGAGGTTTAGGCCAGG + Intergenic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1016543754 6:145196736-145196758 GAAAAGAAAAAGGATGGGCCGGG - Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016950868 6:149578225-149578247 AAGAATAGGAAAGATGGGCCAGG + Intronic
1017226096 6:152022674-152022696 CAAAAGAAAAAGGATGGGCCGGG + Intronic
1017663494 6:156696180-156696202 AAGAAAAAGAAGTAGGGTACAGG - Intergenic
1017689179 6:156946059-156946081 TAAAAGAAGAATAATGGGCCAGG + Intronic
1017934794 6:158995887-158995909 TAAAAGAAGAAGGATGGGCACGG - Intronic
1017964502 6:159252249-159252271 AAGAGGAAGAAGTATGGCTGTGG + Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018493798 6:164326470-164326492 AAACAGAAAGAGTATGGGCCAGG - Intergenic
1018528389 6:164737403-164737425 AAGAAAAAGAAGTTTAGGGCCGG - Intergenic
1018666954 6:166147537-166147559 AAGAAACAGAAGATTGGGCCAGG - Intergenic
1018800066 6:167215031-167215053 AAAAAGAAAAAGTGTAGGCCAGG - Intergenic
1019245831 6:170709028-170709050 AGGAAGAAGAAGCCAGGGCCTGG + Intergenic
1019586516 7:1807321-1807343 AAGAAAAAAATGTGTGGGCCAGG + Intergenic
1019837478 7:3403227-3403249 AAGAAACAGAAGTATAGGTCAGG - Intronic
1019979403 7:4610148-4610170 AAGAAGAAGAAGAATTAGCTGGG + Intergenic
1020058089 7:5132447-5132469 GAGAAGAAGAACTATGGCCCAGG - Intergenic
1020711990 7:11618503-11618525 AAGAAGGAGAAGAATAGGGCGGG + Intronic
1020844495 7:13265866-13265888 AAGTGGGAGAAGTAGGGGCCAGG - Intergenic
1020897872 7:13964796-13964818 AATAAGAAAAAGTATGAACCTGG - Intronic
1021444484 7:20717730-20717752 AAGAAGAGGAAATTTGGGCCAGG - Intronic
1021773018 7:24023886-24023908 AATAAAAAGAAGCATAGGCCAGG - Intergenic
1022565349 7:31394396-31394418 AAGAAAAACAAGTATAGGCCGGG - Intergenic
1022642681 7:32203210-32203232 AAGAAGAAGAAATATGTGGGAGG - Intronic
1023214205 7:37844299-37844321 AAAAAGAAGAAATCTGGTCCAGG - Intronic
1023560802 7:41471465-41471487 AGAAAGAAAAAGTCTGGGCCAGG + Intergenic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023906973 7:44530040-44530062 AAAAAGAAAAAGTAGAGGCCAGG + Intronic
1023909938 7:44546691-44546713 AAGAAGAAGAAGAAGCCGCCAGG + Intergenic
1023922599 7:44641189-44641211 AAGAAGAAAAAGGCTGGGCTTGG - Intronic
1023961185 7:44927703-44927725 AAGAAAAAGAAAAATGGGCTGGG + Intergenic
1023975116 7:45023220-45023242 TAAAAAAAGAAGTCTGGGCCGGG - Intronic
1024630824 7:51245307-51245329 AAGATGAAAGAGTATGGGCTGGG - Intronic
1024642044 7:51337488-51337510 AAGAAAAAGAAGGCTGGGCATGG + Intergenic
1025064626 7:55842620-55842642 AAGAAAAAGAAGGCTGGGCACGG + Intronic
1025237853 7:57246667-57246689 AAGAAGAGAAAGTGGGGGCCAGG - Intergenic
1025823097 7:64989776-64989798 AAGAAGAAGAAGAATAAGCCAGG + Intronic
1026225446 7:68436267-68436289 ATCAAGAAGCAGTGTGGGCCGGG - Intergenic
1026264685 7:68785875-68785897 AAAAAGAAGAAGGTTGGGGCCGG + Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1026643491 7:72148272-72148294 AAAAAAAAAAAGTCTGGGCCAGG + Intronic
1026844308 7:73689340-73689362 AAAAAAAAAAAGTCTGGGCCGGG - Intronic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1028811099 7:95087598-95087620 GATAAGAAGAATCATGGGCCGGG + Intronic
1029090748 7:98046206-98046228 AAGAAGAGGAATGAGGGGCCAGG + Intergenic
1029098056 7:98105019-98105041 TAGAAGTAGAAGTATAGGCTAGG + Intergenic
1029212341 7:98919303-98919325 AAGAAGATGGCGTAGGGGCCAGG + Intronic
1029286979 7:99472561-99472583 TAAAAGAAGAAAAATGGGCCAGG - Intergenic
1029349685 7:100004265-100004287 AAGAAGAAACAGTATTGGCTGGG - Intergenic
1029408236 7:100390697-100390719 AAGAAGAAAAAGAATTAGCCTGG + Intronic
1029424183 7:100486299-100486321 GGGAGGAAGAAGGATGGGCCAGG + Intronic
1029539753 7:101175635-101175657 AAGAAGAAGAAGGCTGGACACGG + Intronic
1029986550 7:104928148-104928170 AAGAAGAGGAAATTTGGGCTGGG + Intergenic
1030009834 7:105154966-105154988 AACAAGAATAAGGGTGGGCCAGG - Intronic
1030153528 7:106429044-106429066 AAGAAGCAGGAGTATGGACCAGG - Intergenic
1030196586 7:106859089-106859111 AAGAAGAAGAAGGAGGTGCAGGG + Intergenic
1030287195 7:107838787-107838809 TAGAAGAAGAAGAATGGTCTTGG - Intergenic
1030391512 7:108933897-108933919 AAGAACAAGCAGAGTGGGCCGGG + Intergenic
1030485343 7:110159200-110159222 TGGAAGAAGAAGAATGGTCCTGG - Intergenic
1031065383 7:117099075-117099097 AAGAAGAAGAAGAAGGTGCTTGG + Intronic
1031096142 7:117423548-117423570 AAGAAAAAGAAGCAAAGGCCAGG + Intronic
1031273033 7:119678705-119678727 AAGAAGAAGACTTTCGGGCCAGG + Intergenic
1031383979 7:121123326-121123348 AAGAAGGACAAATATTGGCCTGG - Intronic
1032135270 7:129271065-129271087 AAAAAAAAAAAGTTTGGGCCGGG + Intronic
1032159689 7:129501244-129501266 AAGAAGCAGGAGTAGGGTCCTGG - Intergenic
1032526744 7:132583561-132583583 AAGAAGAAGAATGAAGGGACAGG + Intronic
1032628638 7:133622268-133622290 AAGAAGAAAAAAAATCGGCCAGG - Intronic
1032858290 7:135854999-135855021 AATAAGAAGAAATATAGGCCAGG - Intergenic
1033125371 7:138702506-138702528 AAGAAGAAGAAGTAAAGGATGGG + Intergenic
1033290149 7:140076644-140076666 AAGAAGAGGAAATTTAGGCCAGG + Intergenic
1033638337 7:143234765-143234787 AAGAAAAAGAGGTTTGAGCCGGG + Intergenic
1033672029 7:143502442-143502464 AAGAAGAAGAAGTGTGGGTGTGG + Intergenic
1034022034 7:147655106-147655128 AAGAAAAAGAAATATGGGCCAGG - Intronic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1034624109 7:152479274-152479296 AATAAAAAGAAGTCTTGGCCGGG - Intergenic
1034680108 7:152922133-152922155 AAGAGGAAGAGGGAGGGGCCAGG + Intergenic
1034857646 7:154567472-154567494 AAGAAGAAGAAGGAAGATCCTGG - Intronic
1034944917 7:155255646-155255668 AAGAAGAAGAAGAAGGGGAAAGG + Intergenic
1035502292 8:99170-99192 AGGAAGAAGAAGCCAGGGCCTGG - Intergenic
1036408536 8:8477500-8477522 AAGGAGAAGAAGGCAGGGCCAGG + Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038264462 8:26027250-26027272 AGGAAGAACAAGTACGGCCCAGG + Intronic
1038297512 8:26309019-26309041 AAAAAGTAGAAATATGAGCCAGG - Intronic
1038545941 8:28425741-28425763 AAGAAGAAGAAGAACAGGCTGGG - Intronic
1038558832 8:28550785-28550807 AAGAAAATGAAGAATAGGCCAGG - Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039815449 8:41090508-41090530 AAGAGGAGGAAGTATGACCCAGG - Intergenic
1039833947 8:41240880-41240902 AAGAATAAGAAAAATAGGCCAGG + Intergenic
1041633170 8:60111048-60111070 AAGAAGCATAATTATAGGCCGGG - Intergenic
1041755336 8:61307463-61307485 AAGATGAAGAAGTATGAGGAAGG + Intronic
1041770063 8:61463769-61463791 AATAATAAAAAGTTTGGGCCGGG + Intronic
1041929163 8:63268201-63268223 AAGCACATGTAGTATGGGCCAGG - Intergenic
1042955933 8:74250674-74250696 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1043793346 8:84503026-84503048 AATAAGAAGAAATATTGGCACGG + Intronic
1044077850 8:87845715-87845737 AAGAAGAAAAAGGTTGGGCAAGG + Intergenic
1045001053 8:97878557-97878579 AAGAAGAAGAAGTCCAGGCATGG + Intronic
1045357515 8:101402784-101402806 AAAAATCATAAGTATGGGCCAGG + Intergenic
1045421097 8:102015937-102015959 AAAAAGAAGAAGGGTGGGGCTGG + Intronic
1045599611 8:103697729-103697751 AAAAAGAAAAAGTTTGGGCAGGG + Intronic
1046517128 8:115277033-115277055 AAGAAGAATAAGTCTGGGCATGG + Intergenic
1047095130 8:121616729-121616751 AAGAAATAGAAGTATGAGCCGGG - Intronic
1047245425 8:123139101-123139123 AAAAACAAGAAATATGTGCCAGG - Intronic
1047449830 8:124955292-124955314 ATGAAAAAGAAATATAGGCCAGG + Intergenic
1047504456 8:125467953-125467975 AAGAAGACGATGCAAGGGCCGGG - Intergenic
1047972882 8:130100622-130100644 CAAAAGAAGAAGTAGAGGCCGGG - Intronic
1048921686 8:139237223-139237245 AAAAAAAAGAATTATAGGCCAGG - Intergenic
1049077361 8:140409784-140409806 AATAAGAAGAAGAAAAGGCCAGG + Intronic
1050326746 9:4505342-4505364 AAAAAAAGGAAATATGGGCCGGG - Intronic
1050438070 9:5629741-5629763 GAGAAGAACAAGTCTGGGCTCGG - Intronic
1050523985 9:6529739-6529761 AATAAAAAGAAATATGGGTCGGG - Intergenic
1050737697 9:8782889-8782911 ATGAAAAAGAAGTGTAGGCCAGG - Intronic
1050829924 9:9998151-9998173 AAGAAGAAGAAGGAATGCCCAGG + Intronic
1050843194 9:10179209-10179231 AAGAAAAAGAACTTTGAGCCAGG + Intronic
1051308013 9:15736645-15736667 AAGAAAAAGAAATGTGAGCCGGG - Intronic
1051546739 9:18283938-18283960 AAGAAGAAGAAGGCTGGGTGTGG + Intergenic
1051705326 9:19872999-19873021 AAGAAGAAGAAGAATGATTCAGG + Intergenic
1051759463 9:20445257-20445279 AAGAAGAAGTATTGTGGGCAGGG - Intronic
1052080419 9:24199065-24199087 AATAAGAAAAAATATTGGCCAGG - Intergenic
1052291532 9:26846980-26847002 AAGAAGAAGAAAAATTGGCCGGG - Intronic
1052531361 9:29688735-29688757 AAGAAAAGAAAGTATAGGCCAGG + Intergenic
1052786337 9:32831705-32831727 AAGAAGATGTAACATGGGCCAGG + Intergenic
1052952526 9:34224540-34224562 AAGAAGCGGAAGTATGAGCAGGG - Intronic
1053093093 9:35297842-35297864 AATAAGACAAAGTAGGGGCCGGG - Intronic
1053242464 9:36507224-36507246 AAGAAGAAGAAGAAATGCCCTGG - Intergenic
1054788546 9:69233475-69233497 AAGATACAGAACTATGGGCCAGG + Intronic
1054999867 9:71436596-71436618 AAGAAAAAGAGGTTTAGGCCGGG - Intronic
1055725467 9:79223147-79223169 AATAAAAAGAAATATTGGCCTGG + Intergenic
1056328016 9:85497166-85497188 AAGAAGAAGAAGAAAGGAGCGGG + Intergenic
1056889197 9:90474068-90474090 AAGAAGAAGAAGAATTGTCTTGG + Intergenic
1057043124 9:91862031-91862053 AAGAAGAAGAAGGCCGGGCATGG + Intronic
1057168280 9:92945210-92945232 AAGAACAAGGGGTCTGGGCCGGG + Intergenic
1057859964 9:98633325-98633347 AAGAATAAGAAGAACAGGCCAGG + Intronic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058481495 9:105400198-105400220 AAGAAAAAGAAGGCTGGGCGCGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058644995 9:107123143-107123165 AAGCAGAAGGAGTATGAGCTTGG + Intergenic
1058701693 9:107606035-107606057 ATGAAAAAGAAGACTGGGCCGGG - Intergenic
1058716018 9:107722549-107722571 TTGAAAAAGAAGTAGGGGCCAGG - Intergenic
1058783677 9:108364984-108365006 AAGAAAAAGAAGTTTAGGCCGGG + Intergenic
1059078483 9:111221083-111221105 AAAATGAAGAAATATAGGCCAGG - Intergenic
1059210343 9:112509189-112509211 AAAAAAAAAAAGAATGGGCCTGG - Intronic
1059680409 9:116580256-116580278 AAGAGGCAGAGGTATGGGGCAGG + Intronic
1060097979 9:120810578-120810600 AAATAGAAGAATTATGAGCCAGG - Intergenic
1060142227 9:121220176-121220198 AAGAAAAGGCAGTGTGGGCCGGG - Intronic
1060162336 9:121375821-121375843 AAGAAGAAGAAATTTGGACACGG - Intergenic
1060369368 9:123055526-123055548 AAGAAGAAGAAATATCTGGCTGG - Intronic
1060483625 9:124032841-124032863 AAAAAAAAGAAGTGTGCGCCCGG + Exonic
1060514248 9:124256072-124256094 AAGGATAAGAAGTTTGGGCCGGG - Intergenic
1060603086 9:124890857-124890879 AAGAAGAAGAAGTAATGACCAGG + Intronic
1060619271 9:125048561-125048583 AAGAAGAAGAAGAAAAGGGCAGG + Intronic
1060623598 9:125090475-125090497 AAGAAGGAGAAGGAAGGGGCAGG + Intronic
1060649218 9:125310826-125310848 AAAAAGAAGAAGGCTGGGCGCGG - Intronic
1060662973 9:125415144-125415166 AAGATGAGGTAGCATGGGCCGGG + Intergenic
1060721247 9:125980595-125980617 AAGAAGAAAAAAAATGGGCCGGG + Intergenic
1060791318 9:126487462-126487484 AAGAAAAACAGGTCTGGGCCAGG + Intronic
1060805513 9:126573465-126573487 AAGAAGAAGAAGTAAGGTGCAGG - Intergenic
1060861602 9:126959355-126959377 CAAAAGAAGATATATGGGCCAGG - Intronic
1061383282 9:130272534-130272556 AAGAAGAAGAAGAAGAGGCCAGG - Intergenic
1062201930 9:135307799-135307821 AAGAAAAAGAAATATGGGTGAGG - Intergenic
1062215328 9:135386033-135386055 CAGGAGATGAAATATGGGCCGGG - Intergenic
1062283486 9:135762450-135762472 AAGAAAAAGAAAAAAGGGCCAGG + Intronic
1062570362 9:137182215-137182237 AAGAAAAAGAAAAAAGGGCCGGG + Intronic
1062714738 9:138003089-138003111 AAAAAAAAGAAATTTGGGCCAGG - Intronic
1062740749 9:138173870-138173892 AAGAAGAACGAAAATGGGCCAGG + Intergenic
1203369052 Un_KI270442v1:285714-285736 AAGAAGAACAAAAATGGGCCAGG - Intergenic
1203415571 Un_KI270582v1:3378-3400 AAAAAGAACAAGTATTGGCCAGG - Intergenic
1203606030 Un_KI270748v1:58239-58261 AGGAAGAAGAAGCCAGGGCCTGG + Intergenic
1185510424 X:660043-660065 AAGAAGAAGAAGGCTGGACGCGG - Intergenic
1185535686 X:860005-860027 AAGAAGAAGAAGAAAAGGCCGGG - Intergenic
1186408148 X:9321797-9321819 AAGAAGAAGAAGGAAAGGGCAGG + Intergenic
1186809276 X:13171402-13171424 AAGCAGAACAAGTATTGGCAGGG + Intergenic
1186918188 X:14246286-14246308 AAGAAGAACTTGTATTGGCCTGG + Intergenic
1187164561 X:16792799-16792821 AAAAATAAAAAGTATAGGCCAGG + Intronic
1187204825 X:17171819-17171841 AAGAATTATAATTATGGGCCAGG - Intergenic
1187793568 X:22977397-22977419 ATCAAGAAGAACCATGGGCCAGG + Intergenic
1188385948 X:29558184-29558206 AAAGAGAAGAAGTATTGGCAAGG - Intronic
1188484063 X:30663168-30663190 AAGAAAACAAAGTATTGGCCGGG - Intronic
1188768280 X:34123724-34123746 AAAAAGAATAAATCTGGGCCAGG - Intergenic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1188886007 X:35550037-35550059 AAAAATAAGAAGTATTGGCAAGG - Intergenic
1189009567 X:37033608-37033630 AAGAACAAGAATTCTGGGACAGG + Intergenic
1189039007 X:37522110-37522132 AAGAACAAGAATTCTGGGACAGG - Intronic
1189314008 X:40040901-40040923 AAGGAGAAGGAGGAGGGGCCAGG - Intergenic
1189449728 X:41117852-41117874 AAAAAGAAGAAAAAAGGGCCGGG - Intronic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189806473 X:44740234-44740256 AAGAAGAAGAAGTGTTTGGCAGG + Intergenic
1190268867 X:48847022-48847044 AAAAAGAAAAAGTTTTGGCCGGG + Intergenic
1190363819 X:49673223-49673245 AAGAAGAAGAAGATCTGGCCAGG - Intergenic
1190413404 X:50158945-50158967 AAGAAGAGGACACATGGGCCTGG + Intergenic
1192130217 X:68542873-68542895 AAGAAGAAGAAGGCTGGGCATGG - Intergenic
1192281369 X:69689628-69689650 AAGAAGAACAAAGTTGGGCCGGG - Intronic
1194610185 X:96034403-96034425 AAGAAAGAAATGTATGGGCCAGG + Intergenic
1194689715 X:96968512-96968534 CAAAAGAAGACATATGGGCCAGG - Intronic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1195242072 X:102961707-102961729 AAGGAGAAGAAAAGTGGGCCAGG - Intergenic
1195677669 X:107519727-107519749 AAGAAGGAGGAGTAATGGCCTGG + Intergenic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196174436 X:112625534-112625556 AAGAATAAGAAGTGTTGGTCAGG + Intergenic
1196826191 X:119742102-119742124 AAGAAAAAGATGTTTAGGCCAGG - Intergenic
1197176498 X:123491767-123491789 AAGAAGAAGAAAAATGGGAGTGG + Intergenic
1197351036 X:125383708-125383730 AAGCAGAAAAAGCATAGGCCAGG - Intergenic
1198439208 X:136645721-136645743 AAGGAGAGGATATATGGGCCTGG + Intergenic
1198440411 X:136657872-136657894 AGGAAGAAGAGGTTTGGGACTGG - Intronic
1198458299 X:136838762-136838784 AAGCAGAAGAGGGATGGGCTCGG + Intergenic
1198505100 X:137293705-137293727 AACAAAATGAAGTATGGGCCGGG + Intergenic
1199830579 X:151545562-151545584 AACAAGAACAAGTTTAGGCCAGG - Intergenic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200298710 X:154950058-154950080 AAGAAGAGGAAATGTGGGCCAGG - Intronic
1201069230 Y:10129245-10129267 AAGAAGAAGAAAAATGGGCCAGG + Intergenic
1201274999 Y:12288284-12288306 AAAAAGAAGAAGAAAGTGCCTGG - Intergenic
1201317364 Y:12661044-12661066 AAGAAGTACAAGTGTTGGCCAGG - Intergenic
1201559657 Y:15302601-15302623 AAGGAGAAAAAGTAGGGGTCAGG - Intergenic
1202071055 Y:20991920-20991942 AAGAATAAGAAGAATGGTCTGGG + Intergenic