ID: 908128447

View in Genome Browser
Species Human (GRCh38)
Location 1:61052066-61052088
Sequence AAAGCGAGCCCTCCCGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908128447 Original CRISPR AAAGCGAGCCCTCCCGCTCC CGG Intronic
908128447 1:61052066-61052088 AAAGCGAGCCCTCCCGCTCCCGG + Intronic
909879564 1:80856768-80856790 CAAGTTAGCCCTCCCGGTCCTGG - Intergenic
915274929 1:154781956-154781978 ATAGAGAGCCCTCCCTGTCCTGG - Intronic
918078504 1:181188678-181188700 AAAGCGAGACCACCTGCTTCAGG - Intergenic
920357062 1:205381610-205381632 CAAGCGAGGCCTCCTGCTTCAGG - Exonic
923110373 1:230885281-230885303 AAAGCTACCCCTCCACCTCCAGG + Intergenic
1068962187 10:62877884-62877906 AAATCAATCCCTCCCTCTCCTGG + Intronic
1069362435 10:67657955-67657977 AAATCTAGCCCTCCCTCTGCTGG - Intronic
1069902424 10:71713729-71713751 ATTGAGAGCCCTCCCCCTCCTGG + Exonic
1073503910 10:103967287-103967309 AAGCCGAGCCCTCCCGCCTCGGG - Exonic
1074544175 10:114389645-114389667 AAAGCCAGCCCTACCACCCCAGG + Intronic
1075562933 10:123481543-123481565 AAAACGAGCACTCCCTTTCCAGG - Intergenic
1075714529 10:124548387-124548409 AAACAGAGCCCTCCCTCTACTGG - Intronic
1085215568 11:74827375-74827397 ACAGCAAGCCCTCCCACTGCAGG - Intronic
1102060265 12:109926292-109926314 AGACCCAGGCCTCCCGCTCCAGG + Intronic
1103004223 12:117408677-117408699 TCAGCGAGCCCTCCCCTTCCAGG + Intronic
1104921873 12:132294768-132294790 TAACAGATCCCTCCCGCTCCAGG - Intronic
1106026410 13:25959975-25959997 AAAGCAAGTCCTCCCATTCCAGG + Intronic
1106373352 13:29158932-29158954 AAGTTGAGCCCTCCCGTTCCTGG - Intronic
1113617294 13:111689764-111689786 AAAGAGGGGCCTCCCGCCCCAGG - Intergenic
1113622823 13:111775034-111775056 AAAGAGGGGCCTCCCGCCCCAGG - Intergenic
1123169370 14:106356710-106356732 AAACAGGGCCCTCCCTCTCCTGG - Intergenic
1123941680 15:25219624-25219646 ACAGCGAGCCTTCCCACTTCAGG - Intergenic
1124227024 15:27903351-27903373 CCAGCCACCCCTCCCGCTCCAGG + Intronic
1131336878 15:91557647-91557669 TAAGCTAGCCCTCCCACTCAGGG - Intergenic
1132656826 16:1044920-1044942 AAAGCGAACCCCGCCCCTCCAGG - Intergenic
1132985214 16:2762588-2762610 AGACCGAGACCTCCCTCTCCTGG - Exonic
1136451688 16:30357444-30357466 AAAGCGAGCACCCCCACCCCAGG + Exonic
1137276527 16:46937937-46937959 AAAGGGGTCCCTCCCGATCCAGG - Intergenic
1138441799 16:57039841-57039863 AAATCGGGCCCTACCTCTCCTGG - Exonic
1142247389 16:88976289-88976311 AAAGAGAGCCCTCCTCCTCCTGG - Intronic
1142747225 17:1965895-1965917 AGAGCGAGCCATCCCTCTCAGGG - Intronic
1147213121 17:38883612-38883634 AAAGTGATCCCTCAGGCTCCAGG - Intronic
1151893693 17:76966202-76966224 CAAGTGAGCCATCCCTCTCCAGG - Intergenic
1152071395 17:78135491-78135513 AAAGCAAGCCCTCGACCTCCTGG + Intronic
1159590172 18:70325431-70325453 AAAGCGCGCCCTCCCACTTGAGG - Exonic
1160136217 18:76274032-76274054 AAAGAGGGCACTGCCGCTCCAGG + Intergenic
1160493411 18:79356342-79356364 AAACCTAGCACTCACGCTCCTGG + Intronic
1161829173 19:6590461-6590483 AAAGGGACCCCTCCCCCACCCGG + Intronic
1162390143 19:10384817-10384839 ACAGCCAGCCCTCCCGCAGCAGG - Intergenic
1162821496 19:13226165-13226187 AGGGCGAGCCCTTCCTCTCCTGG - Intronic
1167261307 19:48460181-48460203 AATGCTAGCCATCCAGCTCCAGG - Intronic
1167264120 19:48474918-48474940 GGAGCCAGCCCTCCCGGTCCGGG - Exonic
946812644 2:223542527-223542549 AAAGCCAGCCATCGCGTTCCAGG + Intergenic
947218174 2:227768126-227768148 GAAGCAAGCCCTGGCGCTCCGGG + Intergenic
947998324 2:234547206-234547228 AAAGACAGCCCTCCCCCTCCAGG + Intergenic
949017305 2:241720655-241720677 CCAGCGAGCCCTTCCGCGCCCGG - Intronic
1175541641 20:59751570-59751592 GAAGAGAGCCCGCCAGCTCCCGG + Intronic
1184227964 22:43141268-43141290 AACGTGAGCCCTCACTCTCCTGG + Intronic
970437362 4:16048555-16048577 AAAGGGAGACCTCCCTCTCCAGG - Intronic
972295030 4:37729337-37729359 AGAGAGAGCCCTCTTGCTCCAGG + Intergenic
974318598 4:60314549-60314571 AAAGCTAAGCCTTCCGCTCCTGG + Intergenic
975609108 4:76186337-76186359 AAAGCGTGTCCTCCTCCTCCAGG - Intronic
984620573 4:181948058-181948080 AAAGCGAGCACTCACTCTCAGGG + Intergenic
996226762 5:121008716-121008738 AAAGCTAGCCCTCAGCCTCCAGG - Intergenic
997409523 5:133680471-133680493 AAAGTAAGCACTCCCTCTCCAGG + Intergenic
1001641519 5:173247227-173247249 AGAGGCAGCCCTCCCCCTCCAGG - Intergenic
1005468791 6:26141576-26141598 AAAGCCAGCCTTCCAGCACCTGG - Intergenic
1008786504 6:55174880-55174902 AAAGAGACCCCTCCCTCCCCCGG + Intronic
1010067426 6:71700690-71700712 AAAGCGAGACCTCTTGCACCAGG + Intergenic
1016409989 6:143772771-143772793 AAAGAGAGCCCTTCCACTCTGGG + Intronic
1022117055 7:27270434-27270456 AAATGGAGCCCTCCACCTCCTGG + Intergenic
1036659339 8:10697927-10697949 GCAGCGAGTTCTCCCGCTCCAGG - Exonic
1037311193 8:17558455-17558477 AAAATGAGCCCTCACTCTCCTGG + Intronic
1037990188 8:23316364-23316386 AAACCCAGCCCTCCCTTTCCTGG - Intronic
1039453901 8:37695896-37695918 GGAGCGAGCCCACCCGCCCCGGG + Exonic
1046819742 8:118621954-118621976 AAAGCGAGGCAGCCGGCTCCCGG + Intronic
1049389844 8:142362026-142362048 ACAGCAAGCCCTCCTGCTGCAGG - Intronic
1049419875 8:142511721-142511743 CAAGAGAGCCCACCCGCCCCAGG - Intronic
1052969785 9:34370428-34370450 AAAGAGAAACCTCCCCCTCCTGG - Exonic
1062084546 9:134641975-134641997 AAGTCGAGCCCTCCCGCCCGTGG + Exonic
1062180011 9:135186260-135186282 AAAGCCAGCGCTGCCGCTCCTGG - Intergenic
1062212968 9:135374399-135374421 AAAGTGAGCCCTGTGGCTCCTGG + Intergenic
1185643640 X:1601536-1601558 GAAGCGAGCGGTCGCGCTCCCGG + Exonic
1187632495 X:21190116-21190138 AAATCCAGCACTCCCGCTACTGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic