ID: 908128736

View in Genome Browser
Species Human (GRCh38)
Location 1:61053978-61054000
Sequence CCGGGCGCCGCCCTCTGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908128736_908128742 14 Left 908128736 1:61053978-61054000 CCGAGCCAGAGGGCGGCGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 908128742 1:61054015-61054037 AGCCGCCTCCTGCAGCCTCGCGG 0: 1
1: 0
2: 3
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908128736 Original CRISPR CCGGGCGCCGCCCTCTGGCT CGG (reversed) Intronic
900121383 1:1049944-1049966 CAGGGCGCCGCCCCATGGCAGGG - Exonic
900307848 1:2019667-2019689 CCGGACGCTGCCCTTGGGCTCGG + Intronic
900341087 1:2189671-2189693 CCGGGCGCCGCACTCTGCGCAGG + Exonic
900616065 1:3566203-3566225 CAGGGCCCGGCCCTCTGGCCCGG - Intronic
901911269 1:12460315-12460337 CAGGGCGCCTGCCACTGGCTTGG - Exonic
902338994 1:15770505-15770527 CCTGCCGCCGCCAGCTGGCTGGG + Exonic
903923409 1:26817399-26817421 CCGGGCGGCGCTCGCTGGCGCGG - Intergenic
903958620 1:27042174-27042196 CAGGTCTCTGCCCTCTGGCTGGG + Intergenic
905221427 1:36450576-36450598 CGCCGCGCCGGCCTCTGGCTCGG - Intergenic
905773665 1:40654246-40654268 GCGGGCGGCGCCTTCCGGCTTGG - Intronic
906198808 1:43946636-43946658 CAGGGCGCCGCCTTCCGGCTAGG + Intergenic
906666737 1:47627411-47627433 CCTGGCCCTGCCCTCTTGCTGGG - Intergenic
907453931 1:54563113-54563135 CCGGGCGGCGCTCGCTGGCGCGG + Intronic
907766936 1:57422312-57422334 CCGGTCCCCGCCGGCTGGCTAGG + Intronic
908128736 1:61053978-61054000 CCGGGCGCCGCCCTCTGGCTCGG - Intronic
912771039 1:112464636-112464658 CCAGGCCCTGCCCTCTGCCTAGG + Intergenic
914666934 1:149840268-149840290 CCCGGCGCGGCCATCCGGCTAGG - Exonic
914668833 1:149853522-149853544 CCCGGCGCGGCCATCCGGCTAGG + Exonic
915737663 1:158094973-158094995 CCAGGCCCCACCCTCTGGCCTGG + Exonic
920333501 1:205228649-205228671 CCGGGCGCGGACCTCCGGCCTGG + Exonic
922718962 1:227890678-227890700 CCTGGAGCCTCCCCCTGGCTGGG - Intergenic
1066126595 10:32347659-32347681 CCGCGCGCCGCCGTCTGCCGCGG + Intronic
1066545809 10:36499137-36499159 CAGGGGACCGCCTTCTGGCTAGG + Intergenic
1069718192 10:70534064-70534086 CCGGGCCACTCACTCTGGCTGGG - Exonic
1069751083 10:70745343-70745365 CCAGGCCCTGCCCTCTGACTTGG + Intronic
1072454163 10:95561503-95561525 CCCGGCACCGCCCGCTGGCCGGG - Intergenic
1074777425 10:116776254-116776276 CTGGACGCCCCCCTCTGCCTCGG + Intergenic
1075206972 10:120456885-120456907 CCAGGGGCCGCCCACTGGCGGGG + Intergenic
1077200776 11:1306435-1306457 CCGGGGGCAGGACTCTGGCTCGG - Intronic
1077403433 11:2370005-2370027 CCGGCCGCTGCCCGCTGGCATGG - Intergenic
1078561549 11:12377451-12377473 CCTCGCGCCGCCCTCTGCCCTGG - Exonic
1079837187 11:25350025-25350047 CCAGGCGGGGCCCCCTGGCTTGG - Intergenic
1079882683 11:25945487-25945509 CCAGGCAGGGCCCTCTGGCTTGG + Intergenic
1081834532 11:46143110-46143132 CCTGCCGCCGCCAGCTGGCTGGG + Intergenic
1084667234 11:70582997-70583019 CAGGGTGCTGCCCTGTGGCTGGG + Intronic
1084953394 11:72678893-72678915 CTGGGTGACTCCCTCTGGCTGGG + Intergenic
1085618865 11:78022681-78022703 CCTGCCCCTGCCCTCTGGCTGGG - Intronic
1088376293 11:109145451-109145473 CCGGCCGCCGCCCTGTCTCTGGG + Intergenic
1091807432 12:3366253-3366275 CCGGGCGCGTCCCGCTGGCCAGG - Intergenic
1092637655 12:10469007-10469029 CCAGGCATAGCCCTCTGGCTTGG - Intergenic
1104787882 12:131461489-131461511 CCTGGGGCTGCCCCCTGGCTGGG - Intergenic
1104910829 12:132240257-132240279 TCAGGCGCCGCCATCGGGCTGGG + Intronic
1104915511 12:132262405-132262427 CCGGGCGGCTGCCTGTGGCTGGG - Intronic
1105750469 13:23418869-23418891 ATGGGCGCCGCCCTCTTCCTAGG + Intronic
1112435300 13:99387615-99387637 ACTGGCGCCCTCCTCTGGCTGGG - Intergenic
1113820449 13:113209275-113209297 CCGGGCACCCCCTCCTGGCTCGG - Intronic
1115689193 14:35826294-35826316 CAAGCCCCCGCCCTCTGGCTCGG + Intergenic
1117424504 14:55580482-55580504 CCGGACGCCGCCCGCTGGGTAGG + Intronic
1119330067 14:73787047-73787069 CCGGGCGCCGGCGTGGGGCTCGG - Intronic
1122348940 14:101076905-101076927 CTGGGCGCCCACCTCTGGGTTGG + Intergenic
1123111276 14:105868116-105868138 CCGGGCCTTTCCCTCTGGCTTGG - Intergenic
1123181974 14:106480027-106480049 CCGGGCGCCGGGCTCAGGCCTGG - Intergenic
1202944931 14_KI270726v1_random:16703-16725 CCGGGCGCCGGGCTCAGGCCTGG + Intergenic
1128067939 15:64775789-64775811 CGGGGCGCCGGCCTCCGGCCGGG + Intergenic
1128322659 15:66703883-66703905 CCGCGCGCCGACCTCCGCCTGGG + Exonic
1129269213 15:74410664-74410686 CTGGCCGCCTCCCTCTGGCTGGG - Exonic
1129605155 15:77021201-77021223 CCGGGAGCCACCCTCAGGCCTGG + Intronic
1132573666 16:655210-655232 CCGAGCACCTCCCCCTGGCTTGG + Intronic
1132885079 16:2178991-2179013 CCGGGCGCTGTCCCCTGGCGAGG + Exonic
1132885301 16:2179711-2179733 CCGGGCTTCGCCCTCGGGCGGGG + Exonic
1136318344 16:29466835-29466857 CCGGGCGGCGGCCTGTGGCCTGG + Exonic
1136432919 16:30206184-30206206 CCGGGCGGCGGCCTGTGGCCTGG + Exonic
1136578070 16:31135779-31135801 CCTGGCCCCGCCCACTGGCTGGG + Intergenic
1138597396 16:58036310-58036332 CCTGTCTCTGCCCTCTGGCTTGG + Intronic
1141054648 16:80804099-80804121 CCCGCCGCCGCCCGCTGACTGGG + Intronic
1141697045 16:85625091-85625113 CAGGGCCCCGCCCTCTCCCTTGG + Intronic
1142780166 17:2175362-2175384 TCGGCCGCCTCTCTCTGGCTGGG - Intronic
1145902201 17:28496388-28496410 CCATGCCCCTCCCTCTGGCTTGG + Intronic
1147242350 17:39098856-39098878 CCGCTCACCGCCCTCTGCCTGGG - Intronic
1147820970 17:43241641-43241663 CCCGGGGCCGCCTTCTGCCTGGG + Intergenic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1151589268 17:75032764-75032786 CCTGCTGCCGCCCTCTAGCTAGG - Intronic
1151954432 17:77373414-77373436 CCGGGCCCTGCGCGCTGGCTGGG - Intronic
1152362378 17:79838818-79838840 CAGGGCGCCGGGCTCGGGCTCGG + Intronic
1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG + Intronic
1152706188 17:81844798-81844820 CCGGGCCCCGCCAGCGGGCTGGG + Intronic
1152777812 17:82213305-82213327 CCCGGCGCTGCCCACGGGCTCGG + Intergenic
1160009075 18:75089976-75089998 CCGGGCTCCGTCCTCAGCCTCGG + Intergenic
1161119303 19:2516721-2516743 CCGGGCCCAGCCCCCTGGCCGGG - Intronic
1161252076 19:3285762-3285784 CTTGGCCCCGCCCTCTGGCCTGG + Intronic
1161581603 19:5083707-5083729 CCCGGCGTCTCCCTCTGGTTTGG + Intronic
1161955048 19:7489045-7489067 CCTGGCCCCGCCCCCTGGCGCGG - Intronic
1162363042 19:10231020-10231042 CCGGGCGGCCCCCACTGCCTCGG - Intronic
1164834492 19:31349041-31349063 CCGGGCGCCGCTCTCCTGTTTGG - Intronic
925161358 2:1686209-1686231 CCGAGCCCCGCCCTCGGGCAGGG - Intronic
927664955 2:25024930-25024952 CCGCGGCCCGGCCTCTGGCTGGG + Intergenic
927692125 2:25215849-25215871 CCAGCAGTCGCCCTCTGGCTCGG + Intergenic
934011595 2:87825502-87825524 CCGGGCGGCGGCCTCGGCCTCGG - Intronic
934011606 2:87825531-87825553 CCGGGCGGCGGCCTCGGCCTCGG - Intronic
934762896 2:96866143-96866165 CCGGGGCCTGCCCTCTGGTTGGG - Intronic
934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG + Exonic
937200676 2:120202606-120202628 CCTGGCACTGCCCTCTGGCAAGG + Intergenic
937905805 2:127052265-127052287 CCCGGCTCGGCCGTCTGGCTGGG + Exonic
946310624 2:218880795-218880817 CCGGGCACCGCCCTCGGGGGGGG - Exonic
947592405 2:231393255-231393277 TGGGGCTCTGCCCTCTGGCTGGG + Intergenic
947860653 2:233354921-233354943 CCGGGCGCCGCGCGCTGGGCGGG + Intronic
948310488 2:236982007-236982029 GAGGGCACCGCACTCTGGCTGGG + Intergenic
948473818 2:238203732-238203754 CCGCGCGCAGCCCTCTGGGGCGG - Intergenic
948788677 2:240366023-240366045 CGGGGAGCAGCTCTCTGGCTGGG - Intergenic
1168975927 20:1965916-1965938 CCCGGCCCCGCCCTCTGGGCAGG - Intergenic
1169244539 20:4015385-4015407 GCGGCCGCCGCCCCCGGGCTGGG - Intronic
1173594181 20:44248005-44248027 CTGCGGGCCGCCTTCTGGCTAGG + Intronic
1175394567 20:58649959-58649981 GCGGGTGCCGCTGTCTGGCTGGG + Intergenic
1175902172 20:62364283-62364305 GTGGGCGGCGCCCTCTGGCTGGG + Intronic
1176383865 21:6127387-6127409 CCAGGGACCTCCCTCTGGCTGGG - Intergenic
1179490618 21:41739188-41739210 CCGGGCGTCGTCCTCTGCCTGGG - Intergenic
1179739608 21:43410851-43410873 CCAGGGACCTCCCTCTGGCTGGG + Intergenic
1182617825 22:31600414-31600436 CTGGTCTCTGCCCTCTGGCTGGG + Intronic
1183546198 22:38455785-38455807 CCGTGCGGCCCCCTCTGTCTCGG + Intergenic
1183664658 22:39240276-39240298 CCTGGCCCCGTCCCCTGGCTGGG - Intronic
1183705542 22:39473124-39473146 CCGAGAGCCGCCCTCTGACGGGG - Intronic
1183994139 22:41620691-41620713 CCAGCCGCCACCCTCTGGCCTGG + Intronic
1184469947 22:44690771-44690793 CCAGGCTCTGCCCTCTGCCTGGG - Intronic
1184557380 22:45240728-45240750 CTCGGCGCCGCCCGCAGGCTCGG + Intronic
1184775335 22:46620310-46620332 CCGGGCGCCGCCCTGAGCCTGGG + Intronic
953404830 3:42654971-42654993 GACGGCGCCGCCCTCGGGCTGGG + Intronic
954111275 3:48434773-48434795 GCTGGCCCCGCCCTCTGACTTGG - Intronic
962198009 3:133380091-133380113 TCGAGGGCGGCCCTCTGGCTTGG - Exonic
963116989 3:141738556-141738578 CCGGGAGCCGACCTCGGGGTTGG + Intronic
968008702 3:195259699-195259721 CCGGGGGCCGCCCTGGTGCTGGG - Intronic
968665833 4:1821964-1821986 CCGGGCTCCGCACTGTGCCTGGG - Intronic
969214472 4:5711187-5711209 CCAGGCTCCTCCCTCCGGCTCGG + Exonic
969214557 4:5711480-5711502 CTGGGCGCCGCGCTCGGCCTCGG + Exonic
969368616 4:6716265-6716287 CCAGGCGGCGCCCTGCGGCTCGG - Exonic
970195519 4:13547374-13547396 ACGGGCGCCACGCTCCGGCTTGG + Intergenic
971250748 4:24971328-24971350 CCGGGGGACGCCCTCGGCCTGGG + Intronic
976398664 4:84583538-84583560 GCGGACGCCGCGCCCTGGCTGGG + Intronic
976733284 4:88284879-88284901 CCGCGCTCCGCCCGCTGGCTAGG - Intergenic
980130025 4:128809823-128809845 CTGGGCGCCGCTCGCTCGCTCGG - Exonic
988968039 5:36439632-36439654 CCAGGCTTCCCCCTCTGGCTTGG - Intergenic
989506442 5:42231341-42231363 CCGGGCAAGGCCCACTGGCTTGG - Intergenic
990772519 5:59265123-59265145 CTGGGTGCCACCCTGTGGCTTGG - Intronic
997120104 5:131164934-131164956 CCGGGCCCTGTCCGCTGGCTGGG + Intronic
1002162099 5:177320443-177320465 CCGAGCACCGCCCTCAGGTTGGG - Intergenic
1003134942 6:3427886-3427908 CCGGCCCCCGCCCTCTGGTCGGG + Intronic
1003661213 6:8064189-8064211 CCAGGCGGCGCCCTCTGACCCGG - Intronic
1005040211 6:21594598-21594620 TCGGGCGCCGGCCTCGAGCTGGG + Exonic
1006448116 6:34091153-34091175 CCGGGAGCAGGCCCCTGGCTGGG - Intronic
1006756788 6:36423291-36423313 CCTGGCGGCGCTCTCTGGCGGGG - Intronic
1019626916 7:2020475-2020497 CCGGGCGTCCCCCTGCGGCTCGG - Intronic
1019724756 7:2595393-2595415 GCGGGCACTGCCCTCTGGGTGGG + Intronic
1020616647 7:10466474-10466496 CCGGGCGGCGCTCGCTGGCGCGG + Intergenic
1024259470 7:47563094-47563116 CCGGGCCAGGCCCTCTGCCTGGG + Intronic
1025976713 7:66376500-66376522 CCGGGAGGCGCCGTCAGGCTGGG + Intronic
1026009822 7:66628404-66628426 CCGGGCGGTGCCCTGCGGCTCGG + Intergenic
1029444232 7:100603887-100603909 AGGGGAGCTGCCCTCTGGCTGGG + Intronic
1029550030 7:101232691-101232713 CTGGGCCCCGCCCTCTACCTGGG - Exonic
1031484407 7:122310598-122310620 CCGGGCGCCGCTGCCGGGCTGGG + Intronic
1034470449 7:151251879-151251901 CCGGCCGCCGCCCGCTCGCTCGG - Intronic
1037886463 8:22598855-22598877 CCTGGGGACGCCGTCTGGCTCGG - Intronic
1039848639 8:41343685-41343707 CCGGGAGGGGTCCTCTGGCTTGG - Intergenic
1048855951 8:138686636-138686658 CCGGGCCCGGCCCTCAGCCTGGG + Intronic
1049336663 8:142090190-142090212 CCCGCCTCCACCCTCTGGCTGGG - Intergenic
1049795617 8:144496123-144496145 CCAGGCGCTGCCCTAAGGCTGGG - Intronic
1049987987 9:970173-970195 CCGGGCCCCGCCCTCCCGCTGGG - Intergenic
1053214282 9:36258104-36258126 CAGGGCTCCGCCGTGTGGCTCGG - Intronic
1055036002 9:71819318-71819340 CTGGGCGCCCCCTTGTGGCTTGG + Intergenic
1057605696 9:96496611-96496633 CCGTGCGTCTCCCTCCGGCTGGG + Intronic
1060209556 9:121701287-121701309 CCATGCCCCGACCTCTGGCTAGG - Intronic
1060813843 9:126624625-126624647 CCACTCGCCGCCCTCGGGCTGGG - Intronic
1062031019 9:134362046-134362068 CCTGGAGCTGCCCCCTGGCTTGG + Intronic
1062444350 9:136587459-136587481 CCGGGCGCCTCCCTCAGACACGG + Intergenic
1062532175 9:137006817-137006839 CTGTGCCCTGCCCTCTGGCTGGG + Intergenic
1062629988 9:137459181-137459203 CCGGGGGTCGCGCTCGGGCTCGG + Exonic
1186739159 X:12498734-12498756 CCAGGTGCCGCCCTATGGATGGG + Exonic
1195954849 X:110318008-110318030 CAGTTCGCCCCCCTCTGGCTCGG - Exonic
1196401511 X:115321872-115321894 CCGTGCCCAGCCATCTGGCTTGG + Intergenic
1198750192 X:139931736-139931758 CTGGGGGCCGCCTTCGGGCTGGG - Intronic