ID: 908128868

View in Genome Browser
Species Human (GRCh38)
Location 1:61054731-61054753
Sequence CCGTCGAGGGCAGGCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908128868_908128877 -6 Left 908128868 1:61054731-61054753 CCAGGCCTGCCTGCCCTCGACGG 0: 1
1: 0
2: 0
3: 15
4: 207
Right 908128877 1:61054748-61054770 CGACGGGGCGGTCTCTCTGCCGG 0: 1
1: 0
2: 1
3: 5
4: 38
908128868_908128885 24 Left 908128868 1:61054731-61054753 CCAGGCCTGCCTGCCCTCGACGG 0: 1
1: 0
2: 0
3: 15
4: 207
Right 908128885 1:61054778-61054800 TAAAACAGTTACTGCACCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 179
908128868_908128883 22 Left 908128868 1:61054731-61054753 CCAGGCCTGCCTGCCCTCGACGG 0: 1
1: 0
2: 0
3: 15
4: 207
Right 908128883 1:61054776-61054798 GGTAAAACAGTTACTGCACCTGG 0: 1
1: 0
2: 0
3: 5
4: 105
908128868_908128884 23 Left 908128868 1:61054731-61054753 CCAGGCCTGCCTGCCCTCGACGG 0: 1
1: 0
2: 0
3: 15
4: 207
Right 908128884 1:61054777-61054799 GTAAAACAGTTACTGCACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 141
908128868_908128878 1 Left 908128868 1:61054731-61054753 CCAGGCCTGCCTGCCCTCGACGG 0: 1
1: 0
2: 0
3: 15
4: 207
Right 908128878 1:61054755-61054777 GCGGTCTCTCTGCCGGCCCCTGG 0: 1
1: 0
2: 4
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908128868 Original CRISPR CCGTCGAGGGCAGGCAGGCC TGG (reversed) Intronic
900651286 1:3731192-3731214 CGGGCGGGGGCAGTCAGGCCAGG + Intronic
901677000 1:10891263-10891285 ACGTCCAGGGCAGGTAGGCAGGG + Intergenic
902690536 1:18107956-18107978 CCGCCGCGGCCAGGCAGCCCGGG - Exonic
903514730 1:23902827-23902849 CCGCCGTGGGCAGGAAGGCCGGG - Intronic
904390884 1:30185093-30185115 CAGGCCAGGGCAGGCAGGCTGGG - Intergenic
905544559 1:38787263-38787285 CGGGCAAGGGAAGGCAGGCCAGG + Intergenic
906199176 1:43948173-43948195 CAGTCCTGAGCAGGCAGGCCTGG + Intronic
908128868 1:61054731-61054753 CCGTCGAGGGCAGGCAGGCCTGG - Intronic
910702112 1:90086721-90086743 CCGTGGTGGTCAGGCTGGCCTGG + Intergenic
913214551 1:116609696-116609718 CAGTCTAGGGAAGGCAGGCAAGG - Intronic
913451129 1:118993322-118993344 CCTGCGAAGGCAGGCAGGACCGG - Intergenic
914755449 1:150559415-150559437 CTGTCAAGGGCAGGCCTGCCAGG + Exonic
915225966 1:154411615-154411637 GCTTTGAGGGCAGGCAGTCCAGG + Intronic
917406374 1:174711677-174711699 CCGTGGAGGGCAGGAGTGCCAGG - Intronic
920339709 1:205268133-205268155 GTGGCGAGGGCAGGCAGGCAGGG + Intronic
923500883 1:234562635-234562657 CCCACGAGGCCAGACAGGCCTGG + Intergenic
1066106538 10:32161960-32161982 CCCTCGACGCCAGGGAGGCCGGG - Intergenic
1067078209 10:43199909-43199931 CAGTGCAGGGCTGGCAGGCCAGG + Intronic
1069718932 10:70538009-70538031 CCGGGGAGGGAAGGGAGGCCAGG + Intronic
1072901264 10:99408952-99408974 TCGTGGAGGGCAGGGAGGCAGGG + Intronic
1074397355 10:113108724-113108746 ACGACCAGGGCAGGCAGTCCTGG - Intronic
1077015264 11:396479-396501 CAATCCAGGGCAGGGAGGCCAGG - Intronic
1077023185 11:428667-428689 CCGGGGAGGGCATGCAGCCCGGG + Intronic
1077047585 11:553261-553283 CCTCAGCGGGCAGGCAGGCCGGG + Intronic
1077049909 11:561900-561922 CTCTCGGGGTCAGGCAGGCCGGG + Intronic
1077216006 11:1395432-1395454 CTGTGGAGGGCATGCAGGGCAGG - Intronic
1081615073 11:44586038-44586060 CAGTGGGGTGCAGGCAGGCCTGG - Intronic
1084363468 11:68683917-68683939 CCGTCGATGGCGGGGAGGGCAGG - Intronic
1089467514 11:118694950-118694972 CCGTGGCGGGCAGCGAGGCCGGG + Intergenic
1089590466 11:119537155-119537177 CTTTCAAGGGCAGGGAGGCCAGG - Intergenic
1090663120 11:128895685-128895707 GCTCAGAGGGCAGGCAGGCCCGG - Intronic
1090937820 11:131360805-131360827 CCATTGAGGGGAGGCAGACCTGG - Intergenic
1091220892 11:133929540-133929562 CTGTGCAGGGCTGGCAGGCCAGG + Intronic
1091263697 11:134253871-134253893 CCGGAGGGGGCAGCCAGGCCGGG - Intronic
1091396246 12:155750-155772 ATGTGGTGGGCAGGCAGGCCAGG + Intronic
1091804201 12:3344105-3344127 CCGGCGGGGGCAGGAAGGGCTGG + Intergenic
1094338977 12:29389561-29389583 TCGTCGAGGCCCGGCAGGCTTGG - Intergenic
1094466006 12:30754675-30754697 CCGGCGAGGGTGGGCAGGTCTGG - Intronic
1096112374 12:49037254-49037276 GCATGGAGGGCAGGCAGGCTTGG - Exonic
1096251090 12:50033039-50033061 GCGTCGGGGGCAGGGAGGCTTGG + Intronic
1096918377 12:55057712-55057734 CCCTCCAGGGCAGGCAGGGAAGG - Intergenic
1097173440 12:57129507-57129529 GGGCAGAGGGCAGGCAGGCCCGG + Intronic
1102228627 12:111247257-111247279 CAGTGGAGGGCATGCATGCCCGG + Intronic
1103852678 12:123943537-123943559 CCAAGGAGGGCAGGCAGCCCTGG - Intronic
1103936838 12:124481489-124481511 CCCTGGAGGGCAGCCAGGGCTGG + Intronic
1104090548 12:125513099-125513121 CCTGCGTAGGCAGGCAGGCCAGG - Intronic
1104838665 12:131809176-131809198 CCCTGGAGGGCAGGGAGGGCTGG + Intergenic
1109875251 13:68394351-68394373 CCAGGCAGGGCAGGCAGGCCAGG + Intergenic
1110842797 13:80161983-80162005 CCTTCCAGGGAAGGCAGGGCAGG + Intergenic
1113456149 13:110450358-110450380 CCGTAGAGCGCAGGGATGCCGGG - Exonic
1113850406 13:113414433-113414455 CCGCAGAGGGCAGGGAGGCTGGG - Intergenic
1114323162 14:21563800-21563822 CCATGGCGGGCAGGCAAGCCGGG - Intergenic
1114558927 14:23577585-23577607 CCAGCGAGGGCAGGCAGGGCCGG + Exonic
1122244162 14:100389804-100389826 CTGGCGAGGAAAGGCAGGCCTGG - Intronic
1122993290 14:105248938-105248960 CCGCCGTGGGCAGGAAGGCCGGG + Exonic
1123041359 14:105491532-105491554 TCGCGGAGGGCAGGCGGGCCGGG + Intronic
1127735497 15:61835223-61835245 CTGGCCAGGGCAGGGAGGCCCGG + Intergenic
1131032480 15:89197736-89197758 CTGTGGAGGACAGGCAGGGCTGG + Exonic
1131072277 15:89473341-89473363 AGGTGGAGGGCAGGCAGGGCAGG + Intronic
1132610533 16:813743-813765 CCGCCCAGGGCAGGCAGGCAGGG - Exonic
1132700769 16:1221094-1221116 CCGTCGTGAGCAGAAAGGCCCGG + Exonic
1135832235 16:25785840-25785862 CGGTGCAGGGCAGGCAGGCAAGG + Intronic
1136028016 16:27482310-27482332 CAGTTGAGGGTAGGCAGTCCTGG - Intronic
1136294434 16:29293555-29293577 CCCTCTGGGGCAGGCTGGCCTGG + Intergenic
1139433113 16:66921751-66921773 CCCTCCAGGGCAGGCACACCCGG + Exonic
1139850882 16:69951121-69951143 CTGTCGGGGGCGGGCTGGCCAGG + Intronic
1139879864 16:70174033-70174055 CTGTCGGGGGCGGGCTGGCCAGG + Intronic
1140091965 16:71846128-71846150 CCGCCGGGGCCAGGCAGGCCTGG + Intronic
1140372655 16:74421515-74421537 CTGTCGGGGGCGGGCTGGCCAGG - Intronic
1141278678 16:82610664-82610686 CCTTCCAAGGCAGGCAGGCTAGG + Intergenic
1142031683 16:87841630-87841652 CCCTCCAGGGCTGGCAGGACAGG + Intronic
1142100336 16:88267599-88267621 CCCTCTGGGGCAGGCTGGCCTGG + Intergenic
1142876240 17:2853509-2853531 CGGGCGAGGGGAGGCAGGGCCGG + Intronic
1144021310 17:11241544-11241566 CCGTCGGGGGCCGGAGGGCCGGG + Exonic
1145007590 17:19346301-19346323 CCGTGGAGGGGAGGAAGGGCAGG - Intronic
1145325922 17:21825285-21825307 CCATTGAGGGGAGGCAGACCTGG - Intergenic
1145874548 17:28307104-28307126 TCGTCGAGGCCCGGCAGGCTTGG - Intergenic
1145994501 17:29097684-29097706 CCATGGAGGGGAGACAGGCCTGG + Intronic
1147726064 17:42566889-42566911 CCGGGGAGGGCAGGCACGGCGGG + Intergenic
1148237014 17:45975790-45975812 CCCTCGAGGGCTGGCAGGGAGGG + Intronic
1149561756 17:57612432-57612454 GCCTTCAGGGCAGGCAGGCCAGG + Intronic
1150338483 17:64346752-64346774 CTCTCAAGGGCAGGCTGGCCTGG - Intronic
1152199161 17:78935166-78935188 CCTTCGAGGGGAGGCAAGCAGGG - Intergenic
1152302065 17:79500823-79500845 ACGTTGAGGGCAGGTGGGCCAGG + Intronic
1152570132 17:81118046-81118068 CCTCCGAGGCCAGGCAGGCAGGG + Exonic
1152608559 17:81304830-81304852 CGGCAGAGGGCAGACAGGCCAGG - Intergenic
1152635710 17:81429774-81429796 TCGTTGAGGGTAGGTAGGCCAGG + Intronic
1152922493 17:83072994-83073016 CCGCCGAGTCCAGGCAGGCATGG + Intergenic
1154390392 18:13931749-13931771 CCCTGGAGGCCAGGCAGGACTGG - Intergenic
1156447625 18:37249086-37249108 CCCTGGTGGGCAGGCAGGCTGGG - Intronic
1158514499 18:58119826-58119848 TGGTCGGGGGCTGGCAGGCCTGG + Intronic
1158870935 18:61687531-61687553 TCTGGGAGGGCAGGCAGGCCAGG - Intergenic
1160897042 19:1407896-1407918 CCGTCAAGGTCACGCCGGCCGGG + Intronic
1161399630 19:4061550-4061572 CGGGCGAGGGCAGGCGGGCAGGG - Intronic
1162399096 19:10433863-10433885 GCGCACAGGGCAGGCAGGCCTGG - Intronic
1162506007 19:11085560-11085582 CCGTGCATGGCAGGCAGGTCAGG + Intergenic
1162615489 19:11797686-11797708 CAGTAGAGGGCAGGCTGCCCGGG - Intronic
1163567952 19:18062841-18062863 TGGTGGGGGGCAGGCAGGCCTGG - Intronic
1164209463 19:23086043-23086065 CCGTCGTGGCCAGGCTGGTCTGG + Intronic
1165852794 19:38860014-38860036 CCGGTGACTGCAGGCAGGCCTGG + Intergenic
1166762686 19:45234718-45234740 CCGTCGAGGGGCGGCGCGCCTGG - Intronic
1167304805 19:48701583-48701605 GCCAGGAGGGCAGGCAGGCCAGG + Intronic
1167501584 19:49851435-49851457 GCCTCGGGGGCTGGCAGGCCAGG - Exonic
1167563925 19:50244346-50244368 AGGTCGTGGGCAGGCAGGCCGGG - Intronic
925845747 2:8031791-8031813 TCGTCGGGGGCAGGTAGGGCTGG - Intergenic
928086280 2:28348278-28348300 CCGGGGAGGGCAGGCAGGATGGG - Intergenic
928369581 2:30731451-30731473 CAGTTCAGGGGAGGCAGGCCTGG + Intronic
929948717 2:46389809-46389831 CCCTGGGGGGCAGGCAGGACGGG + Intergenic
931235494 2:60409380-60409402 CGGTTTAGGGCAGGCAGGGCAGG + Intergenic
932015641 2:68023926-68023948 CCCTCCAGGACAGCCAGGCCAGG + Intergenic
934296020 2:91743464-91743486 CAGTCTAGGGAAGGCAGGCAAGG + Intergenic
934321440 2:91974984-91975006 CCGGCGGTGGCAGCCAGGCCAGG + Intergenic
942946791 2:181681666-181681688 CCGTCCAGGGCGGGCTGGCCAGG - Intergenic
944350906 2:198725314-198725336 CCGTTGAAGGCAGGCAGTTCTGG + Intergenic
947838252 2:233190320-233190342 CAGAGAAGGGCAGGCAGGCCTGG - Intronic
948140630 2:235670012-235670034 GCGGGGAGGGCAGGCGGGCCGGG - Intronic
948636834 2:239343685-239343707 CTGGCCAGGGCAGGCAGGGCAGG - Intronic
948709834 2:239818766-239818788 CCATCCAGGGCAGGCAAGCTGGG + Intergenic
949047222 2:241877653-241877675 CAGTTGAGGTCAAGCAGGCCAGG - Intergenic
1171983307 20:31642177-31642199 TCTTCCAGGGCAGGCAGGCGTGG + Intronic
1172474466 20:35226697-35226719 GCGGCGAAGGCAGGCGGGCCGGG + Exonic
1172512528 20:35510347-35510369 CCTCTGAGGGCAGGGAGGCCAGG - Intronic
1172702826 20:36863383-36863405 ACGTCGAGGCCGGGCGGGCCTGG - Exonic
1173365404 20:42380444-42380466 CCAACCAGGCCAGGCAGGCCTGG - Intronic
1174377722 20:50137580-50137602 CCGTCAAGGTCAGCCAGGCGCGG + Intronic
1175188950 20:57198540-57198562 CCCGCGAGGGCACGCTGGCCTGG + Intronic
1175403869 20:58714974-58714996 ACGTTCAGGGCTGGCAGGCCAGG - Intronic
1175404368 20:58717105-58717127 CCGACGCCGGCAGGCAGGCCAGG - Intronic
1175406874 20:58740719-58740741 CTGAAGAGGGCAGGCAGGTCAGG + Intergenic
1175691353 20:61068075-61068097 CTGTAGAGGGCAGGCAGACGAGG - Intergenic
1175761776 20:61566170-61566192 CCGGCAAGGGCAGGAAGCCCTGG - Intronic
1175874937 20:62224874-62224896 CGGTGGAGGTCAGGCAGACCTGG + Intergenic
1176186727 20:63784232-63784254 CCGCCGGAGGCAGGCCGGCCTGG + Intronic
1176794421 21:13360326-13360348 CCTGGGCGGGCAGGCAGGCCGGG - Intergenic
1178610324 21:34073837-34073859 CCGAGGAGTGCAGGAAGGCCCGG - Intronic
1179022993 21:37656664-37656686 CCGTCCAGCTCAGGCAGGCCGGG - Intronic
1179457139 21:41507717-41507739 CCGTGGAGGGCAGGCGGACTAGG + Intronic
1180034208 21:45235003-45235025 GCCTCGGGGGCAGGCAGGCTGGG - Intergenic
1180846183 22:18983659-18983681 CCCTTGAGAGCAGGCAGGCAGGG - Intergenic
1180898244 22:19352961-19352983 CTGTCCAGGGCAGGAAGGGCTGG + Intronic
1181521086 22:23449175-23449197 ACGCCGCGGGCAGGCAGGACAGG - Intergenic
1181579851 22:23822174-23822196 CTGGCAAGGGCAGCCAGGCCTGG - Intronic
1181583069 22:23838514-23838536 GGGTGGAGGGCAGGCCGGCCGGG - Intronic
1182278676 22:29205958-29205980 GCGGCGCGGGCAGGCAGGCGGGG + Exonic
1183271059 22:36862880-36862902 CCTTGGAGGGCAGCCAGGGCAGG - Intronic
1183347405 22:37315421-37315443 CAGTGGAGGGCAGGAGGGCCAGG + Intergenic
1183987378 22:41576967-41576989 TCGCCCAGGGCAGGCAGGCAGGG + Exonic
1184885509 22:47342685-47342707 CCAACGAGGACAGCCAGGCCCGG - Intergenic
1184887473 22:47355250-47355272 CCGAGGAGGGCAGGCAGACCAGG - Intergenic
1185179702 22:49352170-49352192 CTGCCGAGGGCAGGGAGGCAGGG - Intergenic
1185276927 22:49953847-49953869 CCGGGAAGGGCTGGCAGGCCGGG + Intergenic
1185295272 22:50049940-50049962 CCGCCTGGGGCAGGGAGGCCAGG + Intronic
1185380697 22:50506403-50506425 CCCCCCAGGGCAGGCAGGCAGGG - Exonic
952416729 3:33096820-33096842 CCGTCGGGGGCGGGCCGGGCGGG - Intronic
952890610 3:38037675-38037697 CAGTCCAGGGCAGGCGGCCCTGG + Intergenic
954035634 3:47849552-47849574 CAGGTGAGGGCATGCAGGCCTGG + Exonic
966887158 3:184383097-184383119 CTGGAGTGGGCAGGCAGGCCAGG + Exonic
966945280 3:184773441-184773463 GGGCCGAGGGCAGGCGGGCCGGG - Intergenic
968073466 3:195802496-195802518 CCTTCCAGGGCAGGCAGGGCAGG - Intronic
969588006 4:8105664-8105686 CCGCAGAAGGCAGGCAGGCACGG + Intronic
978449721 4:108819274-108819296 CCATCCAGGCCAGGCTGGCCTGG + Exonic
983045846 4:162985288-162985310 TGGTCGAGGTCAGGGAGGCCAGG + Intergenic
983906551 4:173188953-173188975 CCCTCGAGGGCAGTAAGGCCAGG - Intronic
985724864 5:1510818-1510840 ACCTGGAGGGCAGGCAGGCCTGG + Intronic
985896277 5:2751523-2751545 CCGGCGGAGGCAGGCCGGCCCGG + Exonic
986402249 5:7394103-7394125 GAGTGGAGGGCAGGCAGGACAGG + Intergenic
995847389 5:116508835-116508857 CCTTCAAGGGCAGGCAGGTGAGG - Intronic
999287236 5:150401498-150401520 CCTGCGGGGCCAGGCAGGCCTGG - Intergenic
999437034 5:151571129-151571151 CAGTAGTGGGCAGGCAGGGCGGG - Intergenic
999743432 5:154574132-154574154 CCCTCAGGGGCAGGCAGGGCTGG + Intergenic
1000919370 5:167120076-167120098 CCATGGAGGGCAGGTAGGCTAGG + Intergenic
1001419149 5:171573797-171573819 CGGTATAGGGCAGCCAGGCCTGG - Intergenic
1002097373 5:176839478-176839500 TCGTTGAGCCCAGGCAGGCCAGG + Intronic
1002423399 5:179162248-179162270 GCTTCAGGGGCAGGCAGGCCTGG + Intronic
1002632736 5:180591702-180591724 CCTCTGAGAGCAGGCAGGCCCGG + Intergenic
1005825031 6:29627566-29627588 CCACCGCGGGCTGGCAGGCCTGG + Exonic
1006897792 6:37481972-37481994 CCTTGGAGGGGAGGCAGGCTAGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007735943 6:43982227-43982249 CCATGCAGGGCAGCCAGGCCTGG - Intergenic
1015181478 6:130366142-130366164 CCTCCGAGGGCAGGCGCGCCTGG + Intronic
1019460234 7:1154308-1154330 CCGGCCAAGGCAGGCAGGCATGG + Intronic
1019770864 7:2882984-2883006 ACCTCGGGGGCAGGCTGGCCTGG + Intergenic
1020089975 7:5333399-5333421 CCCTCTAAGGCAGGCAGGCGGGG + Intronic
1023937335 7:44749047-44749069 CCGGCGGGGGCAGGCAGGTGCGG + Intronic
1024322973 7:48088507-48088529 CGGCCGGGGGCAGGCAGGTCCGG + Intergenic
1024607264 7:51032143-51032165 GCTTTGGGGGCAGGCAGGCCTGG - Intronic
1026742675 7:72989013-72989035 CAGCCCAGGGCAGGCAGGGCTGG + Intergenic
1026802526 7:73409413-73409435 CAGCCCAGGGCAGGCAGGGCTGG + Intergenic
1027028788 7:74873718-74873740 CAGCCCAGGGCAGGCAGGGCTGG + Intergenic
1027101060 7:75376064-75376086 CAGCCCAGGGCAGGCAGGGCTGG - Intergenic
1033253010 7:139777327-139777349 CCGGGGAGGGCAGGGACGCCGGG - Intronic
1035018819 7:155788579-155788601 CCTGCGAGGGCAGGGAGGGCAGG + Intergenic
1035108270 7:156459865-156459887 CAGTGGGTGGCAGGCAGGCCAGG - Intergenic
1035528580 8:333839-333861 CCGTCTACGGCACGCAGCCCGGG - Intergenic
1035761738 8:2073543-2073565 CCGGGGAGGGGAGGCAGCCCTGG + Intronic
1036796064 8:11757611-11757633 CTGCAGAGGGCAGGCAGGGCAGG + Intronic
1037503214 8:19505453-19505475 CCTGCGAGTGCAGGAAGGCCAGG + Exonic
1038718429 8:30012189-30012211 CTGTCAGGGGCAGGCAGGTCAGG + Intergenic
1039613518 8:38937334-38937356 CCAGGGAGGGCGGGCAGGCCTGG - Intronic
1039706796 8:40015635-40015657 CCATGGAGGGCAGGTGGGCCTGG + Exonic
1047616198 8:126564405-126564427 CAGTCAAAGGCAGGCAGGCTGGG - Intergenic
1048338268 8:133519105-133519127 CTGGTGAGGGCAGGCAGGGCAGG + Intronic
1048635822 8:136294138-136294160 GCTTCGAAGGCAGGCAGGCCTGG + Intergenic
1049269478 8:141686633-141686655 CAGGCGAGGGCAGGCAGTCGGGG - Intergenic
1049437241 8:142592347-142592369 CCTTCCTGGGCAGGCAGGACTGG + Intergenic
1049693086 8:143971312-143971334 CTGAGGAGGGCAGGGAGGCCAGG - Intronic
1049761088 8:144332340-144332362 CCGGGGCCGGCAGGCAGGCCTGG - Exonic
1051941133 9:22507041-22507063 TCTTGTAGGGCAGGCAGGCCTGG + Intergenic
1054906806 9:70419782-70419804 GCGTGGCGGGCAGGCCGGCCAGG + Intergenic
1060526917 9:124326072-124326094 CCGTGAGGGCCAGGCAGGCCTGG - Intronic
1060827702 9:126696051-126696073 CCTGCCAGGCCAGGCAGGCCTGG + Intronic
1060910451 9:127345707-127345729 CCGACCTGGTCAGGCAGGCCAGG + Intronic
1061196632 9:129110444-129110466 CCGTCCAGGGCCCTCAGGCCCGG + Intronic
1061878822 9:133558222-133558244 CCTTTGATGGCAGGCCGGCCGGG - Intronic
1062052646 9:134455610-134455632 CTGTAGGGGGCAGGCAGGGCTGG - Intergenic
1062216581 9:135392741-135392763 CCGTGGAGGGCAGCCTGACCTGG - Intergenic
1186477962 X:9873466-9873488 GTGTCCAGGGAAGGCAGGCCAGG + Intronic
1187535871 X:20141499-20141521 CAGCCGCGGGCAGGCAGGGCGGG + Intronic
1189054594 X:37685809-37685831 CCGCCGAGGGCACGCGGGCCCGG - Exonic
1199699579 X:150365358-150365380 GTGTCCAGGGCTGGCAGGCCGGG - Intronic
1200119841 X:153785041-153785063 AGGTTGGGGGCAGGCAGGCCGGG - Intronic
1201313686 Y:12621681-12621703 CCGGTGATGGCAGGCAGGCACGG - Intergenic
1201945096 Y:19502791-19502813 CCGTCGTGGCCCGGCAGCCCTGG + Intergenic