ID: 908131926

View in Genome Browser
Species Human (GRCh38)
Location 1:61082822-61082844
Sequence AGCCGCGGCGTGGATGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908131919_908131926 -2 Left 908131919 1:61082801-61082823 CCGCTCTGTCTCACCCAGGTAAG 0: 1
1: 0
2: 1
3: 22
4: 248
Right 908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 65
908131914_908131926 24 Left 908131914 1:61082775-61082797 CCCAGCGCCCGGCAGTTATGTAT 0: 1
1: 0
2: 0
3: 2
4: 24
Right 908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 65
908131915_908131926 23 Left 908131915 1:61082776-61082798 CCAGCGCCCGGCAGTTATGTATT 0: 1
1: 0
2: 0
3: 6
4: 35
Right 908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 65
908131916_908131926 17 Left 908131916 1:61082782-61082804 CCCGGCAGTTATGTATTCTCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 65
908131917_908131926 16 Left 908131917 1:61082783-61082805 CCGGCAGTTATGTATTCTCCGCT 0: 1
1: 0
2: 0
3: 2
4: 60
Right 908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 65
908131913_908131926 25 Left 908131913 1:61082774-61082796 CCCCAGCGCCCGGCAGTTATGTA 0: 1
1: 0
2: 3
3: 37
4: 362
Right 908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908131926 Original CRISPR AGCCGCGGCGTGGATGCGGA GGG Intronic
906526061 1:46493915-46493937 AGCCCCGGCCTGGATCTGGATGG + Intergenic
908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG + Intronic
917436183 1:175023605-175023627 AGGCGCCGCGTTGATGCTGATGG + Intergenic
922764650 1:228150647-228150669 AGGGGCGGCGTGGCTGAGGAGGG + Intronic
1066526345 10:36283800-36283822 AGCCTCGCCGTGGGTGCTGATGG + Intergenic
1075712658 10:124538876-124538898 AGCCGTGGCGTGGCAGAGGAGGG + Intronic
1077325452 11:1962028-1962050 GGGAGAGGCGTGGATGCGGATGG + Intronic
1077919488 11:6632032-6632054 AGTCTGGGGGTGGATGCGGAAGG + Exonic
1078098575 11:8315307-8315329 AGCCGTGGCCTGGCTGAGGAAGG - Intergenic
1079071543 11:17351960-17351982 AGCCGCGGCGATGACGTGGAGGG + Exonic
1081639196 11:44741131-44741153 AGCCGAGGCGTGGTTGTTGATGG + Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1090306876 11:125698818-125698840 AGACGTGGCATGGATGGGGAAGG + Intergenic
1202808433 11_KI270721v1_random:17207-17229 GGGAGAGGCGTGGATGCGGATGG + Intergenic
1093465046 12:19440138-19440160 AGCAGCAGCGGGGATGGGGACGG + Exonic
1096532460 12:52250328-52250350 AGGCGCGGCGTGGGGGCCGATGG + Intronic
1100876673 12:98969110-98969132 AGCTGCCGCCTGGATGGGGAAGG + Intronic
1113441253 13:110330391-110330413 AGGCGCGGGGTGGAGGCGGGGGG + Intronic
1113903301 13:113807907-113807929 AGCCCCAGGGTGGATGAGGATGG - Intronic
1113905732 13:113818388-113818410 GGCCCAGGCGTGGATGCTGACGG - Intergenic
1125516433 15:40323737-40323759 CGCGGCGGCGTGGCGGCGGATGG + Intergenic
1129752820 15:78077684-78077706 GGCCGCGGCGCGGAGGCGCAGGG - Intronic
1132522289 16:397329-397351 CGCCCCGGCGGGGACGCGGAGGG + Intronic
1141088441 16:81113297-81113319 TGCAGCGGCGTGGATGCGGCTGG + Intergenic
1142863326 17:2776548-2776570 AGCCGCGGAGAGGGGGCGGAGGG - Intergenic
1144816511 17:18039247-18039269 AGGCGCGGCGTGGAGGGGGCGGG - Intergenic
1148021651 17:44557591-44557613 AGCCGCAGCGAGGAGGCGGCGGG + Exonic
1150488916 17:65561352-65561374 AGCCGCGGCGTGGGCGCGGGGGG - Intronic
1156495852 18:37524804-37524826 AGCCGCGGCCGGGGCGCGGAGGG - Intronic
1158434680 18:57427831-57427853 GCCCGCGGCCTGGAGGCGGAAGG - Intergenic
1159798453 18:72869079-72869101 AGCCGCGGCGCGGGTGTGGGTGG - Intergenic
1160690964 19:460612-460634 CGCCGCCGAGTGGATCCGGAAGG - Exonic
1160858626 19:1228352-1228374 AGACGCGGCGGGGACTCGGAGGG + Exonic
1161513315 19:4683409-4683431 AAACGCGGCGTAGATGGGGAAGG + Intronic
1163424841 19:17235632-17235654 AGGCGCGGCGTGGAGGCCGGCGG + Exonic
1168471267 19:56642974-56642996 ACCCGCGGCGTGGTTGCAGGGGG - Intergenic
925390464 2:3490578-3490600 GGCCTCGGAGTGGATGGGGAAGG - Intergenic
931517833 2:63059945-63059967 AGCGGCGGCGGGAACGCGGAAGG + Intergenic
949072705 2:242035602-242035624 AGCCGCGGTGTGGGTGAAGAAGG + Intergenic
1173250830 20:41363526-41363548 AGCTCCGGCATGGATGGGGAGGG - Intronic
1173548019 20:43914453-43914475 CCCCGCGGCGTGGGTGCGGGGGG - Intergenic
1176085722 20:63294631-63294653 AGCCTCGCCCTGGAGGCGGAAGG - Intronic
1178914670 21:36699660-36699682 TGCGGCGGCGGGGATGGGGAAGG - Exonic
1180087051 21:45512397-45512419 AGCCACCGCCTGGATGCGGATGG + Exonic
952611580 3:35216320-35216342 AGCCTCGGCCCGGATGCGGTTGG + Intergenic
953661330 3:44893915-44893937 AGCCGTGGGGTGGATGGGAAAGG - Intronic
968599091 4:1500762-1500784 AGCAGAGGTGTGGATGCAGAGGG - Intergenic
975800867 4:78057954-78057976 AGCCGCTTCTTGGATGCTGAAGG + Exonic
978154533 4:105473990-105474012 AGCCGCTGCGTGCCTGCGGTTGG - Exonic
988225321 5:28404955-28404977 AGCCGAGGCGGGGATGAGGATGG + Intergenic
990211220 5:53482775-53482797 AGACCCGGCGGGGATGGGGAGGG - Intronic
996308517 5:122077667-122077689 CGCCGCGGCGCGAACGCGGACGG - Exonic
996432947 5:123401509-123401531 AGCCTCGGCCTGGCTGCGGTTGG + Intronic
997293257 5:132752972-132752994 AGCCCCGGGGTGGAGGCAGAGGG - Exonic
1001617660 5:173056315-173056337 GGCCGCGGCGAGGAGGAGGAGGG - Intergenic
1002434700 5:179224053-179224075 AGGCGCAGCGTGGATGCGGGCGG + Intronic
1003465566 6:6376854-6376876 AGCGGCGGGGTGGGTGGGGAGGG - Intergenic
1009808716 6:68635019-68635041 AGCCGCGGGGTGGGAGAGGAGGG - Intergenic
1018210833 6:161480054-161480076 AGCCTCGGCCTTGATGAGGAGGG + Intronic
1019198705 6:170296809-170296831 AGCCGCCGCGCGGAGGCGGAGGG - Intronic
1019355017 7:573881-573903 GACCCCGGCGTGGATGTGGAGGG + Intronic
1019532584 7:1511129-1511151 AGCCTGGGGGTGGATGGGGAAGG - Intergenic
1029667608 7:102005953-102005975 AGCGGCCGCGTGGATGAGGTTGG + Intronic
1034879716 7:154753790-154753812 TGCCGCTTCTTGGATGCGGATGG - Intronic
1035249858 7:157589872-157589894 AGCGGCGGCGTGGATGAAGAGGG + Intronic
1038963462 8:32547948-32547970 AGGCGCTGCCTGGCTGCGGAGGG + Intronic
1045571342 8:103371672-103371694 AGCCGCTGCGGGGAGGCGGCGGG - Exonic
1049366132 8:142237746-142237768 AGGCCCCGGGTGGATGCGGAGGG + Intronic
1049435753 8:142585532-142585554 AGCCGCGGCCTGGGTGGGCAGGG - Intergenic
1061012565 9:127964094-127964116 AGCCGGGGGGTGGATGAGGCTGG + Intronic
1061329179 9:129881475-129881497 AGACGGGGCGTGGGTGGGGAAGG + Exonic
1203793930 EBV:166145-166167 AGCCCCGGCGGGGATCCGGATGG + Intergenic
1195352724 X:104009943-104009965 TGCCGCGGAGTGGATGCAGAAGG + Intergenic
1199612711 X:149631672-149631694 AGCAGCAGCGTGGACGCGGCTGG - Exonic
1200094133 X:153649408-153649430 AGCTGTGGCCTGGATTCGGAGGG + Exonic