ID: 908133671

View in Genome Browser
Species Human (GRCh38)
Location 1:61103956-61103978
Sequence CTCAAATAAAAGTCAAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908133671_908133672 3 Left 908133671 1:61103956-61103978 CCTGGTCTTGACTTTTATTTGAG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 908133672 1:61103982-61104004 TTTATCTAGAAAAGATGATTTGG 0: 1
1: 0
2: 2
3: 36
4: 479
908133671_908133673 12 Left 908133671 1:61103956-61103978 CCTGGTCTTGACTTTTATTTGAG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 908133673 1:61103991-61104013 AAAAGATGATTTGGTGATGATGG 0: 1
1: 0
2: 7
3: 159
4: 1006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908133671 Original CRISPR CTCAAATAAAAGTCAAGACC AGG (reversed) Intronic
900255392 1:1695555-1695577 CTCAAAAAAAAATAAAGGCCGGG - Intronic
900263953 1:1747786-1747808 CTCAAAAAAAAATAAAGGCCGGG - Intergenic
901587382 1:10308658-10308680 AATAAATAAAAGTCAAAACCAGG - Intronic
901737828 1:11323560-11323582 ATCCCATAGAAGTCAAGACCCGG - Intergenic
904100320 1:28020798-28020820 ATCAAATAAAACTCAAGTGCTGG + Intronic
906667887 1:47634411-47634433 TTCACATCAGAGTCAAGACCTGG + Intergenic
907361621 1:53920875-53920897 AACAAATAAAAGTAAAGGCCGGG + Intronic
907878266 1:58517056-58517078 CACAAATAAGAATCAAGTCCAGG + Intronic
908133671 1:61103956-61103978 CTCAAATAAAAGTCAAGACCAGG - Intronic
908314877 1:62922754-62922776 TTAAAATAAAAGTTAAGGCCAGG - Intergenic
909203269 1:72721002-72721024 CTGAAAGAAAAGTCTAGGCCTGG - Intergenic
909640293 1:77864674-77864696 CTCAAAAAAATGTCAAAACTGGG + Intronic
910967082 1:92818645-92818667 CTCAAATAAAACTAGAGGCCAGG + Intergenic
912042456 1:105409533-105409555 CTGAAATAAAAATCATGGCCAGG + Intergenic
912356933 1:109061893-109061915 CTCAACTAAAAATCAAGGCCAGG - Intergenic
913435007 1:118838038-118838060 GGCAAAGAAAAGTCAAGAACTGG - Intergenic
915295466 1:154918327-154918349 CAAAAAAAAAAGTTAAGACCAGG + Intergenic
921004725 1:211081998-211082020 ATAAAATAAAAATAAAGACCAGG + Intronic
923715697 1:236423133-236423155 CTCCAATAAAAGTCTACAACAGG - Intronic
923953913 1:238993110-238993132 TTCAAATGACAGTCAAGACATGG + Intergenic
924238907 1:242022656-242022678 CTCAAATAAATGTCAAATACAGG + Intergenic
924505589 1:244680427-244680449 CTCAAAAAAAAAAAAAGACCAGG + Intronic
924603794 1:245515047-245515069 CTCGAGTAGAAGTCAAGACCTGG + Intronic
1064080747 10:12306220-12306242 ATCAAATTAAAGTCAAGTCAGGG - Intergenic
1065276001 10:24086144-24086166 CTCTATTAACAATCAAGACCAGG - Intronic
1065299413 10:24307778-24307800 CTCAAAAAAAAGAAAAGAACTGG + Intronic
1066195395 10:33094347-33094369 CTGAAATCACAGTCAAGGCCAGG + Intergenic
1067169709 10:43896728-43896750 CACAAATAAAAGACAAGAGGAGG + Intergenic
1068028023 10:51673014-51673036 GTCTATTAAAACTCAAGACCTGG + Intronic
1070874246 10:79787420-79787442 ATCAAATGAAAGCCAAGAACAGG + Intergenic
1070884836 10:79882719-79882741 CTCAAAGTAAGGTCAAGATCTGG + Intergenic
1071108372 10:82125185-82125207 CTTAAATTAAATTCATGACCGGG - Intronic
1071976997 10:90965079-90965101 CATAAATGAAAGTCAAGAGCAGG + Intergenic
1075726199 10:124612094-124612116 CTCAAATGACTGTCAAGACTGGG + Intronic
1076488776 10:130842221-130842243 CACAAATAAAACCCAAGACAGGG + Intergenic
1077193854 11:1269305-1269327 CTCAAATAGATATCAAGGCCAGG - Intergenic
1080564742 11:33497864-33497886 CTCAAATAAACACCAAGATCTGG - Intergenic
1081328519 11:41775705-41775727 TTCACATAAAATTGAAGACCAGG + Intergenic
1083376867 11:62230652-62230674 GTCAAATTAAAATCAAGAACAGG + Intergenic
1083810665 11:65104376-65104398 CTCCAATTAAAGTCAAAACATGG - Intronic
1084163386 11:67363571-67363593 CTCAAAGAAAAACCAAGGCCGGG + Intronic
1085223963 11:74901761-74901783 TTCAAATAAAAGGCAAGAGATGG - Intronic
1085599447 11:77841803-77841825 CTCAAATAAAAGGCAACATAAGG + Intronic
1086878640 11:92128399-92128421 AGCAAATACAAGTCTAGACCAGG - Intergenic
1087802300 11:102517510-102517532 CTCAAATAAGTGTCAAAAACAGG + Intergenic
1088361602 11:108996203-108996225 CACAAATAAAATTAAATACCCGG - Intergenic
1088825379 11:113489579-113489601 ATCAACTCAAAGTCAAGACCCGG + Intergenic
1092577938 12:9810606-9810628 CTCAGATAAAAGTAAACAGCAGG - Intergenic
1092856233 12:12676220-12676242 CTGAAATAAAAAATAAGACCGGG - Intronic
1092889810 12:12958746-12958768 CTAAAATAAAATTTAAGGCCGGG - Intergenic
1093419619 12:18959856-18959878 CACAAATAAAATTAAACACCTGG - Intergenic
1093584904 12:20822953-20822975 ATCAGACAAAATTCAAGACCAGG - Intronic
1093853265 12:24067224-24067246 CTCAAATAAAAATAAAGAGCTGG + Intergenic
1098896822 12:76072149-76072171 CTCAAATATAAATCAATACTTGG - Intronic
1098967058 12:76802022-76802044 CTCAATAAAAAGTCAATACATGG - Intronic
1100063132 12:90606175-90606197 TTAAATTAAAAATCAAGACCAGG + Intergenic
1100534245 12:95491805-95491827 CTCAAAAAATAGTAATGACCAGG - Intronic
1103112306 12:118291154-118291176 CTCAAAAAAAAGTAAAAACCCGG - Intronic
1106224745 13:27776351-27776373 CCCAAATAGAAGTCTAGACTAGG + Intergenic
1110575192 13:77047696-77047718 ATCAGATAAAGGACAAGACCTGG + Intronic
1111282279 13:86042723-86042745 CTTACATAAGAGTCAAGGCCAGG + Intergenic
1112513809 13:100034263-100034285 TTAAAATAAAATACAAGACCGGG + Intergenic
1112942583 13:104883104-104883126 CTCAAATATATGTCAAAAGCGGG + Intergenic
1114887991 14:26879260-26879282 CTCAAAAAAAAGTCTAGGACTGG + Intergenic
1114983978 14:28202799-28202821 TTCAAATAAAAGCCAAAATCAGG + Intergenic
1115381168 14:32741109-32741131 CTAAAATAAAATTAAATACCAGG - Intronic
1115510191 14:34130897-34130919 CTCAAGTAAAAGTTTAAACCAGG + Intronic
1116543547 14:46133479-46133501 CTTAAATAAAAGTAAAGACAAGG + Intergenic
1117868774 14:60176059-60176081 CTTAAATGAAAGTGAAGGCCGGG + Intergenic
1119084373 14:71726559-71726581 TGGAAATAAAAGCCAAGACCTGG - Intronic
1120175147 14:81285850-81285872 CTAAAATAAAAGTTGAGGCCGGG + Intronic
1120786543 14:88543071-88543093 CTCAGATAACAGTCAAGATAAGG + Intronic
1122622803 14:103069360-103069382 CTCAAAAAAAAATAAAGGCCGGG + Intergenic
1123763405 15:23450469-23450491 CTCAAAAAAAAGAAAAGACCGGG - Intergenic
1124327981 15:28783586-28783608 CTCAAAAAAAAAAAAAGACCGGG - Intergenic
1125588712 15:40841014-40841036 CTAAAATAAAAGTTGAGGCCAGG - Intergenic
1126975379 15:54172412-54172434 TTCATATAAAATTCAAGAACAGG - Intronic
1128583953 15:68831081-68831103 CTAAAATAAAAGACAATTCCTGG - Intronic
1128922605 15:71625491-71625513 CTCAAATAAAAGAGAAAAACAGG + Intronic
1129650219 15:77480963-77480985 CTAAAATAAGAGTCAACAGCAGG + Intronic
1131444093 15:92481477-92481499 CTGAGTTCAAAGTCAAGACCCGG - Intronic
1133569878 16:7030791-7030813 CTCAAATAAGAGGCAGGTCCAGG + Intronic
1134373660 16:13649571-13649593 TTAAAATAAAAGTTAAGGCCGGG - Intergenic
1135343697 16:21669828-21669850 TTAAAATAAAAGTCAGGGCCAGG + Intergenic
1136180753 16:28550190-28550212 CTCAAAAAAAAGTAAAAATCAGG - Intergenic
1137286405 16:47019594-47019616 CTAAAATAAAAGTCACAACCTGG - Intergenic
1138131962 16:54487599-54487621 TTAAAATATAAGTCAAGAGCTGG - Intergenic
1138568770 16:57853926-57853948 ATCAAATAAAAATTAAGGCCAGG - Intronic
1139619378 16:68124730-68124752 CTCAAAAAAAAGAGAAGGCCGGG - Intronic
1140109249 16:71988920-71988942 CTCCAGGAGAAGTCAAGACCTGG - Intronic
1142897233 17:2989331-2989353 CTCAAAAAAAAGACATGAACAGG - Intronic
1143333180 17:6152916-6152938 CTCCAATCAAGTTCAAGACCTGG - Intergenic
1145741187 17:27275958-27275980 CGCAAATAAAAGTCCTGGCCAGG - Intergenic
1148255832 17:46131180-46131202 CTTAAATAAATGTAAAAACCAGG - Intronic
1150341410 17:64370980-64371002 CTCAAATAAAAGTAAAAAAGGGG + Intronic
1150987898 17:70220035-70220057 CTCAAATAAAATACAAGAAAAGG - Intergenic
1151834970 17:76576673-76576695 CTCAAAAAAAAATCCAGGCCGGG + Intronic
1155119785 18:22806522-22806544 CAAAAAAAATAGTCAAGACCCGG + Intronic
1155390955 18:25336081-25336103 CTCAAATAAAATTAAAGCACCGG + Intronic
1155917380 18:31569866-31569888 CTCAAGTAAAAGTAAAGGGCAGG + Intergenic
1156120193 18:33833712-33833734 AACAAATAAAATTCAAGACGGGG - Intergenic
1156349515 18:36291291-36291313 ATAAAATAAAACTAAAGACCAGG - Intergenic
1156852262 18:41742357-41742379 TTCTAATAAAAGTCAGGGCCAGG - Intergenic
1158283221 18:55850656-55850678 CACAAATAATAGTCATGACTTGG - Intergenic
1158340190 18:56457909-56457931 CTGAAATAAAAGTTAAGTCAGGG - Intergenic
1162929484 19:13950166-13950188 CTCAAATAAAAAACAAAACAAGG - Intronic
1163281572 19:16321522-16321544 AGAAAATAAAAGTCCAGACCAGG + Intergenic
1163794283 19:19327618-19327640 CTCTAATAAAAGTAGAGGCCGGG - Intronic
1166702320 19:44889224-44889246 CCCACAGAAAAGGCAAGACCTGG - Exonic
1166835680 19:45666378-45666400 CTAAAATAAAAGTTAAGGCCAGG + Intergenic
925974361 2:9131140-9131162 CACAAATAAAATTAAACACCAGG + Intergenic
926242681 2:11100578-11100600 CTCAAATAGAGGTCAAGTTCAGG - Intergenic
926610612 2:14942892-14942914 CCATAATAAAAGGCAAGACCTGG + Intergenic
927623101 2:24682843-24682865 CAGAAATATATGTCAAGACCTGG - Intronic
928051565 2:28002089-28002111 TTCATATAACAGTAAAGACCAGG + Intronic
928705589 2:33946413-33946435 CTCAAATCAAATTCATGACATGG + Intergenic
928941324 2:36730366-36730388 CTTCCATAAAAGCCAAGACCAGG - Intronic
929057598 2:37891749-37891771 CTCAAAGAAGAGCCTAGACCAGG + Intergenic
930968865 2:57369238-57369260 CTCAAAGAAAAGGGAAGTCCAGG - Intergenic
931489345 2:62726739-62726761 TTCAAATAAAAAACAAAACCAGG - Intronic
931706791 2:64952835-64952857 CACAGAGAAAAGCCAAGACCAGG + Intergenic
931735750 2:65192275-65192297 CTTAATAAAAAGACAAGACCAGG + Intergenic
932108799 2:68974209-68974231 CTCAGATAAAAGTTAAGAAGTGG + Intergenic
932888198 2:75566352-75566374 CTGAAAAAAAAGACAAGGCCTGG - Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
936339210 2:111616641-111616663 CTCCAATTACAGTCAAGTCCTGG + Intergenic
939021876 2:136966976-136966998 GTTAAATAAAAGTCAAGGCTAGG - Intronic
940447385 2:153792058-153792080 CTAAAATAAAAGTTAAAACATGG + Intergenic
941523654 2:166580641-166580663 AGAAAATAAAACTCAAGACCAGG - Intergenic
942289817 2:174457748-174457770 TTAAAAAAAAAGTCAAGGCCTGG - Intronic
942892094 2:181002933-181002955 CTGAAAGAAAACTCAACACCCGG + Intronic
943222446 2:185127767-185127789 CTAAAATAACAGTAGAGACCAGG + Intergenic
944915912 2:204360005-204360027 ATCAAATAAATGTCAAGGCCAGG - Intergenic
945382541 2:209158276-209158298 CTTTAATAAAAGTCAAGCCATGG - Intergenic
945597840 2:211817167-211817189 CTTAAACAAAAATGAAGACCTGG + Intronic
945622765 2:212162341-212162363 TTCAAATAAAATTCTAGAACAGG + Intronic
945675128 2:212846679-212846701 CTGAAATAAAAGTCAAAAAATGG + Intergenic
945693544 2:213073190-213073212 CACAAATAAAAGTTAATACGAGG + Intronic
946106431 2:217374122-217374144 CTAAAATAAAAGCAAAGAACAGG - Intronic
946520859 2:220463386-220463408 CTGAAATCAAAGTCAAAAACAGG - Intergenic
1169171513 20:3469562-3469584 CTCAAAAAAAAAAAAAGACCTGG - Intergenic
1169629050 20:7605452-7605474 CACAAATAAAATTAAATACCAGG + Intergenic
1170385628 20:15813316-15813338 CTCATATAAAAGGCAAAACAAGG + Intronic
1173533281 20:43787238-43787260 TTTAAATAAATGTCAAGAACTGG + Intergenic
1174250871 20:49218683-49218705 AGAAAATAAAAATCAAGACCAGG - Intergenic
1175095726 20:56540070-56540092 CTCAAAAAAAAAATAAGACCAGG + Intergenic
1177378152 21:20300769-20300791 CTCAAATGAAAGTCAAGAAAAGG - Intergenic
1177677747 21:24324232-24324254 CTCAAATAATTGTTGAGACCTGG - Intergenic
1177936450 21:27352336-27352358 TTAAAATAAAAGTCAAAAACAGG + Intergenic
1178337899 21:31760153-31760175 CTAAAATAAAAGTTAAGGCCGGG + Intergenic
1178577574 21:33808191-33808213 CTCAAAAAAAAAAAAAGACCAGG + Intronic
1178879682 21:36439444-36439466 CTCAAATAAATGAAAAGACCGGG + Intergenic
1185106666 22:48874538-48874560 CTCAAAGAAAACTCCAGACCTGG - Intergenic
1185286699 22:50003799-50003821 CTCAGATAAAAAACAAGACAAGG + Intronic
950934605 3:16825738-16825760 CCCAAAAAAAGGTCAAGAGCTGG + Intronic
955611777 3:60765376-60765398 TTCAAATAAAAGTGAATATCAGG + Intronic
956604094 3:71054118-71054140 CTCAAACAAAATTCAAGTCTGGG - Intronic
959050138 3:101516795-101516817 CTAAAATAAAAGTCAAAAAAGGG + Intergenic
960521065 3:118655821-118655843 CACAAATAAAATTAAATACCTGG - Intergenic
961521904 3:127471962-127471984 CTCAAATAAGTGACAGGACCAGG + Intergenic
963120531 3:141772835-141772857 CTAAAATAAAAGTTGAGGCCGGG + Intergenic
963435346 3:145259145-145259167 CTCACATAAAAGTTAATTCCTGG + Intergenic
965993943 3:174855420-174855442 CCAAAATAAAAGTCAAAACCAGG - Intronic
967747453 3:193073283-193073305 CTTAAATAAAAGTAAAAAACAGG + Intergenic
968470347 4:778936-778958 CTCAAAAAAAATAAAAGACCCGG - Intergenic
969813151 4:9665353-9665375 CTTAACTAAAAGGCTAGACCAGG + Intergenic
969964193 4:10977197-10977219 CTCAAAATAAAGTTAAGATCTGG + Intergenic
970287146 4:14530714-14530736 CTTAAAGAGAAGTCAAGGCCAGG + Intergenic
971335961 4:25724418-25724440 CTCAAAGAAAAGAAAAGACAAGG + Intergenic
971819734 4:31536053-31536075 TTCTAAAAAAAGTAAAGACCAGG - Intergenic
972562475 4:40240859-40240881 GTCAAATAAAACTTAAGGCCAGG + Intronic
972962130 4:44466286-44466308 CACAAATAAAATTAAATACCTGG + Intergenic
975290677 4:72674839-72674861 CTCAAATATCATTCAAGAGCAGG + Intergenic
976393824 4:84534499-84534521 ATTAATTAAAAGTCAAGGCCAGG + Intergenic
976961971 4:90988389-90988411 CCAAAAAAAATGTCAAGACCAGG - Intronic
978436953 4:108695739-108695761 TTAAAATATAAGTCAAGGCCAGG - Intergenic
978612744 4:110562078-110562100 CTCAAGTAAAACTTAAGCCCAGG - Exonic
978883669 4:113740535-113740557 CTCACATTTAAGTCAAGACCTGG + Intronic
980936550 4:139231501-139231523 CTCAAAAAAAATTCAAGGCTGGG - Intergenic
980941106 4:139275206-139275228 CTCAAAGCAACGTCAAGATCAGG - Intronic
982061928 4:151613506-151613528 TTCAAAGAAAATTCAAGCCCAGG - Intronic
983949645 4:173624293-173624315 AACAAATAAAAGTCCAGAACTGG - Intergenic
984359826 4:178714289-178714311 CTCAAAGCAAAATCAAGTCCTGG + Intergenic
986698241 5:10376982-10377004 CTAAAATAAAAGTTATAACCAGG + Intronic
987870329 5:23609563-23609585 CACAAATAAAATTAAATACCTGG - Intergenic
989781925 5:45277052-45277074 CTAAAATAATAGTGTAGACCAGG - Intronic
991378106 5:65987559-65987581 CTCAAAAAAAAGTCCAGGCGTGG + Intronic
996087671 5:119321214-119321236 CTCAAAAAAAAGACTAGACTTGG + Intronic
996191142 5:120543366-120543388 CCCAGATAAAAGTCAACACCAGG - Intronic
998209056 5:140179994-140180016 CTCCAAAAAAAGCCAAGACCAGG - Intronic
998812166 5:145977208-145977230 CTAAAACAAAAGACAAGACAAGG + Intronic
1000587284 5:163116007-163116029 CTCCAAGAAAAGTAAAGCCCAGG - Intergenic
1002620850 5:180487185-180487207 CTCAAAAAAAAAGAAAGACCAGG - Intergenic
1003289536 6:4767716-4767738 CTGTAATAAAAATCAAGACCTGG + Intronic
1003768497 6:9268960-9268982 CTCAAATAAAAGCAAATACCAGG - Intergenic
1003865360 6:10357869-10357891 CCCAAACAAAAGTAAATACCTGG + Intergenic
1005500508 6:26425196-26425218 CTTCAATAAAAGTGAATACCAGG - Intergenic
1005665397 6:28047746-28047768 CTCATGTAAAAGGCAAAACCAGG + Intergenic
1006889199 6:37410238-37410260 CTCAAAAAAAATTAACGACCGGG + Intergenic
1007657647 6:43461467-43461489 AACAAATAAAAGACAAGGCCGGG - Intergenic
1009329971 6:62406258-62406280 CGAGAATAAAAGTCAACACCTGG - Intergenic
1009452925 6:63822512-63822534 CTCAAATGAAAGTTCAGACATGG - Intronic
1009809321 6:68640007-68640029 CTCAAATAAAATTCCAGACCAGG - Intronic
1010082213 6:71877080-71877102 TGGAAATAAGAGTCAAGACCAGG + Intergenic
1013005818 6:106072583-106072605 TCCTAATAAAACTCAAGACCCGG + Intergenic
1013549673 6:111195094-111195116 CTAAAATCAAAGACAAGGCCTGG - Intronic
1013621280 6:111891953-111891975 CTAAAATAAAAGTTAAGGCTGGG - Intergenic
1016443759 6:144111412-144111434 CTCACACAAAAGTCAATTCCAGG + Intergenic
1016445646 6:144129417-144129439 CTAAAATAAAAGTCAAAAAAAGG + Intergenic
1016859592 6:148704477-148704499 CTCAAAGAAAAGGAAAGAGCTGG + Intergenic
1017162934 6:151382548-151382570 CTCAAAAAAAAAAAAAGACCAGG - Intronic
1017625174 6:156340718-156340740 CCCTAATAAAAGCCAAGTCCAGG + Intergenic
1022356022 7:29615291-29615313 ATCAAATAAAAGTAAAAAACAGG + Intergenic
1022433856 7:30359116-30359138 TTGAAATAAAAGTCAATTCCAGG + Intronic
1025771851 7:64515705-64515727 CTCAAATAAAAAACAAGGCCTGG + Intergenic
1025932416 7:66006823-66006845 TTTAACTAAAAGGCAAGACCAGG - Intergenic
1028241477 7:88426197-88426219 TTCAAATAAGATTCAATACCGGG - Intergenic
1028628544 7:92905862-92905884 TTCAAATAAAATTCAAAAACAGG - Intergenic
1029312770 7:99682851-99682873 CCCAAATAAAACTAAATACCTGG - Intergenic
1029433423 7:100547368-100547390 CTCAAATAAAAATCCAGAATAGG - Intronic
1030713220 7:112778245-112778267 CAAAAATAAAAGCCAAGCCCAGG - Intronic
1030942936 7:115678173-115678195 TTCAAAAAAAAATCAAGGCCAGG - Intergenic
1031950942 7:127891516-127891538 CTCAGATAATATTCAATACCTGG - Intronic
1032861349 7:135882918-135882940 CTAAAATAAAAGTTGAGGCCAGG + Intergenic
1033932649 7:146543470-146543492 CTCACATGAAGGTCAAGAACAGG - Intronic
1034194947 7:149239488-149239510 GTCACTCAAAAGTCAAGACCAGG - Intergenic
1037043627 8:14270034-14270056 TTAAAATAAAAATCAAGTCCAGG + Intronic
1037487453 8:19361912-19361934 CTCAAATAGGAGTCAAGGCTGGG - Intronic
1037633738 8:20681001-20681023 TTTATATAAAAGTCAAGGCCGGG - Intergenic
1038912962 8:31987871-31987893 CTAAAATGAAGGTAAAGACCTGG - Intronic
1040940160 8:52824807-52824829 CCCAAATGAAGGTCAACACCTGG - Intergenic
1041728384 8:61039838-61039860 CTAAAATAAAAGTCAAAATTAGG - Intergenic
1043068668 8:75610410-75610432 ATAAAATAAAATTAAAGACCAGG + Intergenic
1044046279 8:87438020-87438042 CTCATATAAAGTTCAAGAACAGG - Intronic
1044103733 8:88175047-88175069 CTCAAAAAGCAGTCAAGGCCAGG - Intronic
1044757627 8:95481425-95481447 CTCAAATAAAAATGAACCCCAGG + Intergenic
1045556918 8:103223410-103223432 CTCAAAGAAAAGTAAAGAGCAGG + Intronic
1047805256 8:128352762-128352784 CTCAAATAAAACTAAAAACTGGG - Intergenic
1048969294 8:139635454-139635476 CTGAAATAACAGGGAAGACCCGG + Intronic
1053321871 9:37105937-37105959 CTCAACTAAAAGTCAAAGCATGG - Intergenic
1056143891 9:83710101-83710123 CACAAATAAACATCTAGACCTGG - Intergenic
1056807227 9:89738197-89738219 CTCAAATAAAACCCAAAAGCTGG + Intergenic
1056980742 9:91309085-91309107 TTAAGATAAAAGTTAAGACCAGG - Intronic
1057399480 9:94710560-94710582 ATCAATAAAAAGTCAAGGCCGGG + Intergenic
1058035915 9:100252647-100252669 ATAAAATAAAAGTGAAGATCAGG - Intronic
1058468562 9:105253723-105253745 CTCAAAAAAAAATAAAGACAGGG - Intronic
1058915970 9:109566067-109566089 CTAAAATAATAGGCAAGACATGG + Intergenic
1058990223 9:110248824-110248846 TTCAAATAAAAATCAAGGCCGGG + Intronic
1060598951 9:124865145-124865167 CTTAAATGAAAGTCTAGGCCGGG + Intronic
1061474942 9:130858853-130858875 CACAAATAAGAGCCAAGAGCGGG - Intronic
1061518155 9:131101638-131101660 CTAAAATGGAAGTCAAGGCCCGG - Intronic
1062473610 9:136717285-136717307 TACAAATAAATGTCAAAACCAGG - Intronic
1187034259 X:15521269-15521291 GTCATATAAAAGTCAAAATCAGG - Intronic
1187230128 X:17413903-17413925 CCCAAATACAAGGCAGGACCTGG - Intronic
1188087814 X:25923036-25923058 TTCATATAAAGTTCAAGACCAGG + Intergenic
1188251696 X:27903810-27903832 CTCAAACAGAAGTCAAGCACTGG - Intergenic
1190340189 X:49290270-49290292 CACAAACAGAAGGCAAGACCCGG - Intronic
1190453150 X:50600895-50600917 CCCAAATAAAAGTCAATGCTGGG + Intronic
1191987563 X:66999052-66999074 CTCAAATAAAAATCAACATTAGG - Intergenic
1192627214 X:72742592-72742614 CTCAAAGTCAAGTCAAGACATGG - Intergenic
1192654494 X:72978221-72978243 CTCAAAGTCAAGTCAAGACATGG + Intergenic
1193105381 X:77665372-77665394 CTCTAATAATATTCAAGACAGGG + Intronic
1195562917 X:106305105-106305127 CACACATAAAATTAAAGACCTGG - Intergenic
1195754860 X:108190619-108190641 AAAAAATAAAATTCAAGACCGGG + Intronic
1198415620 X:136417012-136417034 AAAAAATAAAAATCAAGACCAGG + Intergenic
1198420029 X:136462202-136462224 TTAAAATAAAAGTTAAGGCCGGG - Intergenic
1199342832 X:146702228-146702250 CTAAAATAAAAGTTCAGGCCAGG - Intergenic
1199765027 X:150935206-150935228 TTCAAATGAAAGTCCAGACTAGG + Intergenic
1200310771 X:155074694-155074716 CTGACATAAAACTCAAGACGAGG - Intronic
1201452613 Y:14132701-14132723 CTCAAATGAAAATGAAGACAAGG + Intergenic
1201699665 Y:16866878-16866900 CTCAAATAAAATCCAAGAATAGG - Intergenic