ID: 908139211

View in Genome Browser
Species Human (GRCh38)
Location 1:61166211-61166233
Sequence CATTATAGGTAGATATTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908139211 Original CRISPR CATTATAGGTAGATATTGAA TGG (reversed) Intronic
903552191 1:24165614-24165636 CATTTTAGTTAGAACTTGAAAGG - Intronic
904868224 1:33599345-33599367 TATTATATCTAGATATTGACAGG - Intronic
907935495 1:59038079-59038101 CATTCTAGGTATATATCTAAAGG + Intergenic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
909541329 1:76794606-76794628 CATTATTGGTTGATTTTTAATGG - Intergenic
909879141 1:80850504-80850526 TAATATAGGTAGTTATAGAATGG - Intergenic
910418119 1:87023683-87023705 CATGATAAGGATATATTGAATGG + Intronic
912115986 1:106408657-106408679 CATTGTAGGAAGATAGTTAAAGG + Intergenic
912197570 1:107417077-107417099 GATGATGGGTAGATATTGAATGG - Intronic
915587274 1:156850887-156850909 CATTATAGGTAGGCCTTGACTGG + Intronic
916352542 1:163867773-163867795 AATTCTAGGTGGAAATTGAAAGG - Intergenic
916842980 1:168619247-168619269 CAGTAGAGAGAGATATTGAATGG - Intergenic
917190856 1:172417217-172417239 CATTATAGGAAGCTGTAGAATGG - Intronic
921035069 1:211369276-211369298 AATTATAGGAAGATATTCACAGG - Intronic
1065252795 10:23833709-23833731 AATTATAGAAAGATATTGAATGG - Intronic
1066033860 10:31459776-31459798 AAATATGGGTAGATATTTAAAGG - Intronic
1067218056 10:44319428-44319450 AATTATAGGTATGTATGGAAAGG + Intergenic
1068845299 10:61664889-61664911 CTTTTTAGGTAAATACTGAAAGG + Intronic
1069241665 10:66147669-66147691 AAATATAGATATATATTGAAAGG - Intronic
1071149332 10:82615602-82615624 CATTTTAGTTAGAAATAGAATGG + Intronic
1074519531 10:114206333-114206355 GAGTATAGATTGATATTGAACGG + Intronic
1074643713 10:115419426-115419448 CATTCAAGGTAGTTATTGATAGG - Intronic
1075491955 10:122879255-122879277 GAGTTGAGGTAGATATTGAACGG - Intronic
1077996727 11:7459054-7459076 CATTCTGGGTATATTTTGAAGGG + Intronic
1078879170 11:15431238-15431260 CATTCTAGATACATATTTAAAGG + Intergenic
1078965825 11:16340936-16340958 CATTATAAATAGATATTTTAGGG - Intronic
1082110556 11:48268967-48268989 CATGACAGGTAGGTATTGGAGGG + Intergenic
1082720026 11:56663157-56663179 CATTACAGGTAGACATAGATAGG - Intergenic
1084130817 11:67132921-67132943 GGTTATAGGTAGAAATGGAAAGG + Intronic
1086252203 11:84829506-84829528 CATTATTCTTAGATATGGAAAGG + Intronic
1086337499 11:85813524-85813546 AATTCTAGGTTGACATTGAAGGG + Intergenic
1090114789 11:123957103-123957125 CATTATGGGTGTATATTCAAAGG - Intergenic
1090810554 11:130237450-130237472 CATTAGAGGTTTACATTGAACGG + Intronic
1093537083 12:20235184-20235206 CATTGTAGGTAGAGACTGAAAGG + Intergenic
1093962168 12:25286212-25286234 CATTATAGGTAAATGTAGTAGGG - Intergenic
1094256019 12:28427416-28427438 CATTACAGGGAGATACTGATGGG + Intronic
1095623010 12:44281204-44281226 AATTATACGTAAATATTTAAAGG - Intronic
1099552154 12:84060045-84060067 CATTGTAAGTAGATTTTGAGAGG + Intergenic
1099879156 12:88445597-88445619 AATTTTAGGGAGATATTAAAGGG + Intergenic
1101156590 12:101933474-101933496 CATTACAGGCAGATACTGAAAGG - Intronic
1103887272 12:124212085-124212107 CATTATATGGAAATATGGAAAGG - Intronic
1108197301 13:48007819-48007841 CATTATAGGTAGATAATTATAGG - Intergenic
1109843441 13:67951440-67951462 GATTATAGGTATATATGAAAGGG + Intergenic
1111233628 13:85378517-85378539 CATTATAAATAGATATAAAATGG - Intergenic
1113735639 13:112677255-112677277 CATCACAGGCAGAGATTGAATGG + Intronic
1115152398 14:30301125-30301147 AATTTAAGGTAGAGATTGAAAGG - Intergenic
1116727358 14:48577171-48577193 CATTATGGTTATATTTTGAAAGG - Intergenic
1116743533 14:48788081-48788103 AATTATATGTATATATTTAATGG - Intergenic
1116944772 14:50826410-50826432 CATTATGGGTGGTTATTGAGTGG - Intronic
1121592968 14:95133602-95133624 AATTATAGGAAGAGTTTGAATGG - Intronic
1123396264 15:19940451-19940473 AATATTAGGTAGATAATGAAGGG + Intergenic
1124476144 15:30036629-30036651 CATTTAATGTAGATATTTAATGG + Intergenic
1124733386 15:32220052-32220074 TATTATAGGTTGAAAATGAAAGG - Intergenic
1125248556 15:37672368-37672390 CACTATAGGGAGCTGTTGAAAGG - Intergenic
1127908317 15:63394071-63394093 CTCTATAGGTAGAGTTTGAATGG + Intergenic
1129792182 15:78348763-78348785 CAAAATAGGTAGAGACTGAAAGG - Intergenic
1130360241 15:83177743-83177765 CACTTTAGGAAGATATAGAAAGG + Intronic
1130500173 15:84491416-84491438 CATTATATTTAGAAATTAAATGG - Intergenic
1131392233 15:92058867-92058889 CATTGCAGGCAGAGATTGAAGGG - Intronic
1131725753 15:95222227-95222249 CATTCCAGGTAGTTATTGATAGG + Intergenic
1134339997 16:13336037-13336059 AATTATAGTTAAATACTGAAGGG + Intergenic
1136947282 16:34668234-34668256 CATTATCGGATGAAATTGAATGG - Intergenic
1137552439 16:49448456-49448478 CATAATATATAGATATTAAAAGG - Intergenic
1142938009 17:3353696-3353718 CATGATAGGTATATATTTATAGG + Intergenic
1143226037 17:5304277-5304299 CATTATAAGTAGCCATTGCATGG + Intronic
1143251862 17:5528867-5528889 CAGTTTAGCTAGATATTAAATGG - Intronic
1143936296 17:10488289-10488311 CATTGTAAGTAATTATTGAAAGG + Intergenic
1144054605 17:11528485-11528507 CTAGATAGTTAGATATTGAAAGG + Intronic
1144442319 17:15294543-15294565 CATTATAGAACTATATTGAAGGG - Intergenic
1149142474 17:53450034-53450056 CATTTTAAATACATATTGAAAGG - Intergenic
1150032910 17:61759062-61759084 CATTCAAGGTAGGTATTGAAAGG - Intronic
1150048797 17:61938607-61938629 CATAATAGGTGGATAATTAAAGG - Intergenic
1150182368 17:63137498-63137520 CATTAAAGCTAGAAATTAAATGG + Intronic
1154180363 18:12133058-12133080 GATTATAGGAAGATATTTAATGG - Intergenic
1155752658 18:29446724-29446746 CTTTAAAGGTAGATTTTTAATGG - Intergenic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1158826952 18:61232478-61232500 CATAATATGTAGATTCTGAAGGG + Intergenic
1158912390 18:62078035-62078057 CATTTTAGTTACCTATTGAAAGG + Intronic
1159677779 18:71307172-71307194 CTTTATAGCTGGATATTAAAAGG + Intergenic
1161947774 19:7449018-7449040 CATTATAGGTAGGTAGGAAAGGG + Intronic
1165552308 19:36597842-36597864 TAAAATAGGTAGATATTAAAAGG + Intronic
925095581 2:1197111-1197133 CATTTAAGGTAGTTATTGATAGG - Intronic
927014404 2:18942791-18942813 CAGTAAAAGTAGGTATTGAAAGG + Intergenic
929922960 2:46185636-46185658 GAATACAGGTAGATATTAAAGGG + Exonic
931706145 2:64947957-64947979 CATTAATGGAAGAGATTGAATGG - Intergenic
932739896 2:74283392-74283414 CATCATAGGAAGAGATTCAATGG + Intronic
932946016 2:76232268-76232290 AATTATAGTTAGAGATAGAAGGG - Intergenic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
933092151 2:78134935-78134957 ACTTCTAGGTAGATATTCAAGGG - Intergenic
933279103 2:80312827-80312849 CTTTAAAGGTAGATATTAGAAGG - Intronic
936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG + Intergenic
936900814 2:117480381-117480403 CATTAAAGGTAGATCTTTAAGGG - Intergenic
940268582 2:151866731-151866753 AAAGATAGGTAGATATTAAAGGG - Intronic
941355693 2:164488512-164488534 CATTCCAGGTAGAAATTTAATGG + Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941731102 2:168919154-168919176 AATTATAGATAGATTATGAAAGG - Intergenic
942291890 2:174481308-174481330 TATTTTAGGTAGATGTTTAAAGG + Intronic
945279149 2:208018884-208018906 CTTTATATGTAGATATAGAGTGG - Intronic
947475623 2:230445440-230445462 AATTGGAGGAAGATATTGAAAGG + Intronic
1169840440 20:9929834-9929856 CATTATTGGCAGCTAGTGAAGGG + Intergenic
1171540356 20:25946728-25946750 TTTTATAATTAGATATTGAAAGG + Intergenic
1173542188 20:43862424-43862446 CATTTTGGTTTGATATTGAATGG + Intergenic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1178114090 21:29399173-29399195 CCTAATAGGGAGATGTTGAATGG - Intronic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1180566270 22:16668471-16668493 GATTATGGGAAGATATTTAATGG + Intergenic
1180659212 22:17451243-17451265 CATTACAGGTAGATTTTTAAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956928624 3:74017279-74017301 CATTATAGGTAGCTATCTATGGG - Intergenic
957183476 3:76911739-76911761 CATAAAAGGTAGATATCAAAAGG + Intronic
959402396 3:105919334-105919356 CATTCAAGGTAGTTATTGATAGG + Intergenic
959426773 3:106199728-106199750 GTTTATAGGAAGATATTGTATGG + Intergenic
962034193 3:131633338-131633360 CATTATAGGTACCCATTGTAAGG + Intronic
962253650 3:133855532-133855554 CATTATGGGTAGCTTTTGAAGGG - Intronic
963994411 3:151690994-151691016 CATTAAAAGTAGATTTTTAAAGG - Intergenic
968011257 3:195279214-195279236 TAATTTTGGTAGATATTGAATGG - Exonic
971199395 4:24498329-24498351 CATCATAAGTAAATATTTAAGGG - Intergenic
971835431 4:31756934-31756956 CATTAAAGGAATTTATTGAAAGG - Intergenic
972919775 4:43924269-43924291 CATTATAGTTATAAATAGAAAGG - Intergenic
974512032 4:62855596-62855618 TAATATAAGTAGATATTGTAAGG + Intergenic
974750834 4:66138769-66138791 TATTCTAGGTAAATATTAAAAGG + Intergenic
974984037 4:68996774-68996796 CATTTTAGGTGGATAATTAATGG - Intergenic
977017485 4:91710162-91710184 CATTAAAGGTAGTTATTGATAGG - Intergenic
977446167 4:97135901-97135923 CATTATATATACATATAGAATGG + Intergenic
977639185 4:99335871-99335893 CTTTATATGTAGATATTGGGTGG - Intergenic
978892368 4:113845496-113845518 CATTATTGTTATATCTTGAATGG - Intergenic
979536470 4:121826551-121826573 TATTTTAGGAAGATAATGAAAGG + Intronic
982212364 4:153048697-153048719 CATTATTGGTATATACTCAAAGG - Intergenic
982344336 4:154340251-154340273 CATTAAATGAAGATATTAAAGGG + Intronic
982456858 4:155620248-155620270 CATTACTGGAAGATACTGAAAGG + Intergenic
982593789 4:157352109-157352131 AATTATATGTAGATATTTACTGG + Intronic
982776386 4:159445681-159445703 CCTTCTAGATGGATATTGAAAGG + Intergenic
986713750 5:10507349-10507371 CATTATAGGTAGCTAGATAATGG - Intronic
986713753 5:10507417-10507439 CATTATAGGTAGCTAGATAATGG - Intronic
987801737 5:22706198-22706220 CAAAATATGTAGATATTGAATGG - Intronic
987811152 5:22838053-22838075 CATTGTAGGGAGATATTTGATGG + Intronic
988042057 5:25902180-25902202 AATTAGAGGCAGATGTTGAAGGG + Intergenic
988333992 5:29881357-29881379 CATTCAAGGTAGTTATTGACAGG - Intergenic
988923620 5:35966620-35966642 AATTATGGGAAGACATTGAAGGG - Intronic
989545462 5:42667405-42667427 CCTTAAAGGAAAATATTGAAAGG - Intronic
991029656 5:62069383-62069405 CATGATAGGGACATATTAAAAGG + Intergenic
991065765 5:62423095-62423117 CAGTATAGGAAGATACTGAATGG + Intronic
992427611 5:76674029-76674051 TATTAAAGGTAGATTTTCAAGGG + Exonic
994015884 5:94964834-94964856 CATTAAAGGTAATTATTGATAGG + Intronic
998516132 5:142755842-142755864 CTTTATAGGTAGTTTTTGAATGG + Intergenic
1004435931 6:15594091-15594113 TATTATAAGTAGATATTGTTAGG - Intronic
1007888467 6:45260312-45260334 CATTTTTGGTAGGTATTAAAGGG + Intronic
1008025328 6:46629451-46629473 TATTATAGGTACATAAAGAAGGG + Intronic
1008465489 6:51825612-51825634 CATTATAGTTAGATAGTGGCTGG - Intronic
1008677152 6:53831576-53831598 CATTATCAGGAGATCTTGAAGGG - Intronic
1009959929 6:70506910-70506932 CTTTATAGCTTGATATTCAATGG + Intronic
1010148311 6:72698552-72698574 CATTATATGAACATGTTGAAAGG + Intronic
1010456802 6:76065026-76065048 CATTATAGTTACATCCTGAAGGG - Intronic
1010456805 6:76065062-76065084 CATTATAGTTACATCCTGAAGGG + Intronic
1010903567 6:81457722-81457744 CATTTTAGGAAGATAGGGAAAGG - Intergenic
1010966780 6:82219324-82219346 CATTATAGGCATATATTGTAGGG - Intronic
1011567303 6:88689975-88689997 CATTATATGTTGGTAGTGAAGGG - Intronic
1011930621 6:92707365-92707387 TATTATAGGTAGATATGTATAGG + Intergenic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1014050662 6:116949895-116949917 AATGATAGGCATATATTGAATGG + Intergenic
1014272807 6:119351822-119351844 GATTATAGGTACATATTAAAGGG + Intergenic
1014347801 6:120296600-120296622 CATTATAGGTAATTATTAATAGG + Intergenic
1015672064 6:135701869-135701891 AATAATAGGTAGAGATTGATTGG + Intergenic
1017603535 6:156109022-156109044 TATTTCAGGTAGATTTTGAATGG - Intergenic
1017831479 6:158134208-158134230 AATAAAAGGTACATATTGAATGG + Intronic
1018274939 6:162120400-162120422 CATCACAGGTAGGTATTGCAAGG + Intronic
1018421723 6:163646017-163646039 CATTATAGGTATAAATCAAAAGG + Intergenic
1020846582 7:13292530-13292552 CTTAATAAGTAGTTATTGAATGG + Intergenic
1021242987 7:18227674-18227696 CATTATTAGTTGATACTGAAGGG - Intronic
1023463634 7:40428888-40428910 CATTTAAGGCAGATATTGAGAGG + Intronic
1024152530 7:46587387-46587409 CATAATAGGTAGAAATTAAATGG + Intergenic
1024829776 7:53437132-53437154 CATCTTAGGTAGAAAATGAAGGG - Intergenic
1024904968 7:54367258-54367280 CATTATAGGTTTATATTTACAGG + Intergenic
1027401739 7:77815971-77815993 CATTTCAGTTAGATATTGTAAGG + Intronic
1027403022 7:77828284-77828306 CATTATAATTAGCTATTTAAAGG + Intronic
1027886029 7:83906180-83906202 AATTAAATGTAGATTTTGAAAGG + Intergenic
1028365946 7:90032325-90032347 CAATACAGTTAGAAATTGAAAGG - Intergenic
1028573140 7:92314660-92314682 CATATTAGGTAGATATGGAGAGG - Intronic
1028827615 7:95291394-95291416 CATTTTAGAGAGATTTTGAATGG + Intronic
1030471649 7:109971359-109971381 CATATTAGGTATATATTCAAAGG + Intergenic
1035069983 7:156137347-156137369 CATTATGGTTAGATATAGTAAGG - Intergenic
1036542052 8:9725014-9725036 TATTACCTGTAGATATTGAAAGG + Intronic
1036597286 8:10225345-10225367 CATTATGATTAGAGATTGAATGG + Intronic
1040970610 8:53133047-53133069 CCTTATGGGTAAATATTCAAAGG + Intergenic
1045171446 8:99674568-99674590 CATTCAAGGTAGTTATTGAAAGG + Intronic
1046250716 8:111627010-111627032 CATTCAAGGTAGTTATTGATAGG + Intergenic
1047163526 8:122409506-122409528 CATTATGGTGAGTTATTGAACGG - Intergenic
1048064622 8:130955120-130955142 CTTTATAGGTAGAGACTGACAGG + Intronic
1048747009 8:137625499-137625521 CATAATAGGGAGTTATTGTATGG + Intergenic
1050059554 9:1692210-1692232 CATTATAGGTTGAAAATAAAAGG + Intergenic
1050130289 9:2405475-2405497 CATTCAAGGTAGTTATTGATAGG - Intergenic
1050446704 9:5730478-5730500 CATTTTAGGTAAAAATTAAAGGG + Intronic
1050846087 9:10221138-10221160 CTTTATAGGAAGACATTGATAGG - Intronic
1050910469 9:11063191-11063213 CATTATAAGTATATTTTGACAGG - Intergenic
1052184328 9:25573141-25573163 GAATGTAGGTAGATATTTAAAGG - Intergenic
1053540863 9:38972332-38972354 CCTGATAGGTAGACTTTGAATGG - Intergenic
1053805280 9:41795384-41795406 CCTGATAGGTAGACTTTGAATGG - Intergenic
1054139978 9:61519967-61519989 CCTGATAGGTAGACTTTGAATGG + Intergenic
1054625276 9:67391574-67391596 CCTGATAGGTAGACTTTGAATGG + Intergenic
1055175135 9:73309326-73309348 CAATAGAGGTAGAAATTGATTGG - Intergenic
1056122091 9:83498703-83498725 CTTTGAGGGTAGATATTGAAAGG - Intronic
1057542048 9:95984462-95984484 CATTTGAGGTAGATCTTGAATGG - Intronic
1058416585 9:104795163-104795185 CATTTTAGCTAAATCTTGAAGGG + Intronic
1188828101 X:34861800-34861822 CATTTATGGTAGATATTGAGGGG + Intergenic
1192901588 X:75504185-75504207 CATTATAAGTAGATAAGAAATGG + Intronic
1192997583 X:76528528-76528550 CATTATAAGTATATACTCAAAGG - Intergenic
1193862915 X:86693347-86693369 CAGTATATGTAAAGATTGAAGGG - Intronic
1194951001 X:100125790-100125812 CTTCATAGGCAGATACTGAAAGG + Intergenic
1195375041 X:104218759-104218781 CATTATAGGGAGCCATTGACAGG + Intergenic
1196041245 X:111206544-111206566 CCTTATAGGTTGATAGTAAAAGG - Intronic
1198590515 X:138175298-138175320 CATTATAGGGAGTTGTTTAATGG + Intergenic
1199275515 X:145937682-145937704 CATTACAAGAAAATATTGAATGG - Intergenic
1201218268 Y:11742426-11742448 CGTTATGGAAAGATATTGAATGG + Intergenic
1201747131 Y:17389134-17389156 GATGTTAGGTAGATATTAAATGG + Intergenic