ID: 908139224

View in Genome Browser
Species Human (GRCh38)
Location 1:61166396-61166418
Sequence TATGGAACACAGACGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908139224_908139230 18 Left 908139224 1:61166396-61166418 CCCAGCTCCGTCTGTGTTCCATA No data
Right 908139230 1:61166437-61166459 ATCAGAAGATCCACCCACACTGG 0: 1
1: 0
2: 7
3: 67
4: 1589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908139224 Original CRISPR TATGGAACACAGACGGAGCT GGG (reversed) Intronic
No off target data available for this crispr