ID: 908139224 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:61166396-61166418 |
| Sequence | TATGGAACACAGACGGAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 908139224_908139230 | 18 | Left | 908139224 | 1:61166396-61166418 | CCCAGCTCCGTCTGTGTTCCATA | No data | ||
| Right | 908139230 | 1:61166437-61166459 | ATCAGAAGATCCACCCACACTGG | 0: 1 1: 0 2: 7 3: 67 4: 1589 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 908139224 | Original CRISPR | TATGGAACACAGACGGAGCT GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||