ID: 908140430 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:61178914-61178936 |
Sequence | GAGATTGGGCTCCCTGCCTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908140426_908140430 | 3 | Left | 908140426 | 1:61178888-61178910 | CCCTAATGAGCAGATTATCACTG | No data | ||
Right | 908140430 | 1:61178914-61178936 | GAGATTGGGCTCCCTGCCTGTGG | No data | ||||
908140427_908140430 | 2 | Left | 908140427 | 1:61178889-61178911 | CCTAATGAGCAGATTATCACTGT | 0: 1 1: 0 2: 1 3: 16 4: 166 |
||
Right | 908140430 | 1:61178914-61178936 | GAGATTGGGCTCCCTGCCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908140430 | Original CRISPR | GAGATTGGGCTCCCTGCCTG TGG | Intronic | ||