ID: 908140430

View in Genome Browser
Species Human (GRCh38)
Location 1:61178914-61178936
Sequence GAGATTGGGCTCCCTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908140426_908140430 3 Left 908140426 1:61178888-61178910 CCCTAATGAGCAGATTATCACTG No data
Right 908140430 1:61178914-61178936 GAGATTGGGCTCCCTGCCTGTGG No data
908140427_908140430 2 Left 908140427 1:61178889-61178911 CCTAATGAGCAGATTATCACTGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 908140430 1:61178914-61178936 GAGATTGGGCTCCCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908140430 Original CRISPR GAGATTGGGCTCCCTGCCTG TGG Intronic